主题:Dendritic

+ 关注 ≡ 收起全部文章

Exovesicles from Human Activated Dendritic Cells Fuse with Resting Dendritic Cells Allowing Them to Present Alloantigens

【摘要】  Dendritic cells (DCs) can release microvesicles, but the latter??s numbers, size, and fate are unclear. Fluorescently labeled DCs were visualized by laser-scanning microscopy. Using a Surpass algorithm, we were able to identify and quantify per cell several hundred microvesicles released from the surface of stimulated DCs. We show that most of these microvesicles are not of endocytic origin but result from budding of the plasma membrane, hence their name, exovesicle. Using a double vital staining, we show that exovesicles isolated from activated DCs can fuse with the membrane of resting DCs, thereby allowing them to present alloantigens to lymphocytes. We concluded that, within a few hours from their release, exovesicles may amplify local or distant adaptive immunological response.
--------------------------------------------------------------------------------
Dendritic cells (DCs) are antigen-presenting cells with a unique ability to induce primary immune responses. They are present in trace amounts in most tissues, but they are particularly abundant and act as sentinels in organs providing an environmental interface, such as the skin, the respiratory system, and the gastrointestinal tract. Because of their location, immature dendritic cells (iDCs) are profoundly influenced by the environment and transmit danger signals to cells of the adaptive immune system. The presence of pathogens activates iDCs and triggers their maturation, resulting in enhanced expression of co-stimulatory molecules such as CD86 and CD80 and maturation markers such as CD83. Once activated, DCs migrate to lymph nodes where antigen presentation leads to the maturation and proliferation of specific T-cell clones, which in turn migrate to injured tissue.1
In the late 1980s, an alternative antigen pathway was identified as a complement to the classic pathway of lymphocyte activation. This alternative route involves, for instance, the release by follicular DCs of immune complex-coated bodies (iccosomes), thus increasing the delivery of immunogens to antigen-specific B cells in the lymph nodes.2,3 The various types of vesicles released into the extracellular medium from eukaryotic cells appear to have different origins: microvesicles are the result of membrane surface shedding; eg, iccosomes are produced by follicular DCs,2 argosomes carry membrane-bound morphogens, as described in Drosophila embryos,4 and exosomes are the result of an exocytosis of multivesicular bodies.5-7 Exosomes have raised immunological interest because they originate from compartments of the endocytic pathway which are sites of peptide loading on major histocompatibility complex (MHC) class II molecules.8,9
The shedding of membrane vesicle, or exovesicle, is thought to originate from the plasma membrane, using a mechanism similar to that of viral budding.10 Exovesicles bear most of the surface antigens expressed on the plasma membrane, with a selective enrichment in components including human leukocyte antigen class I molecules and integrins.11 Their diameter ranges between 0.1 and 1 µm, and their function has been associated to the function of the cell from which they originate.12,13 Many types of cells release exovesicles, but so far little is known on those originating from DCs. On the other hand, the release of exosomes by DCs has been established.14,15 Exosomes are defined as microvesicles of endocytic origin, cup-shaped, and 0.05 µm in diameter. The proteins found in the membrane are mostly related to T-cell signaling and T-cell activation, such as MHC class II, MHC class I, and CD86, but there are also adhesion molecules, such as tetraspan, and integrin proteins. The rate and relevance of the release of exovesicles versus exosomes has not yet been established.
In this study, using three-dimensional reconstructed pictures of DCs obtained by laser-scanning microscopy (LSM), we were able to identify, and quantify per cell, the secretion of microvesicles within a few hours after a danger signal such as lipopolysaccharide (LPS). These microvesicles appeared not to be of endocytic origin but seemed to be shed from the surface of DCs similar to iccosomes. Using double vital staining, we examined the interaction of exovesicles with DCs not yet activated by danger signals. We demonstrated that these exovesicles from activated DCs can fuse with the membrane of resting DCs and that they are able to transfer alloantigens to activate T cells. Our results demonstrate the origin and magnitude of the release of exovesicles by stimulated DCs potentially able to amplify even distant innate and adaptive immunity.

【关键词】  exovesicles activated dendritic dendritic allowing alloantigens

Materials and Methods

Monocyte Isolation and Differentiation to DCs

Monocytes generated from peripheral blood mononuclear cells of healthy human donors were isolated by Ficoll-Hypaque density gradient centrifugation of buffy coats as described previously,16 after spontaneous aggregation,17 and rosetting.18 In brief, Ficoll-Paque-purified peripheral blood mononuclear cells were suspended in RPMI 1640 medium (Invitrogen Life Technologies, Basel, Switzerland) supplemented with 10% fetal calf serum (Biochrome AG, Berlin, Germany), 2 mmol/L glutamine, 100 U of penicillin per ml, and 100 U of streptomycin per ml, referred to as complete culture medium containing 2 µg of polymyxin B sulfate mlC1 (Sigma-Aldrich, Buchs, Switzerland). Cells were incubated for 40 minutes at 4??C for aggregation. Rosetting was applied to deplete contaminant lymphocytes. Monocyte-enriched fractions were incubated overnight with sheep red blood cells (BioM?rieux, Geneva, Switzerland). Monocyte fractions characterized by high expression of CD14 (more than 85%) and low expression of CD83 and CD86 (less than 5%) were then isolated by Ficoll-Hypaque density gradient centrifugation. Differentiation of DCs from monocytes was performed as originally described by Sallusto and Lanzavecchia19 by culture cells in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) (10 ng mlC1) and interleukin-4 (10 ng mlC1) for 6 days. The cells were kept at 37??C in a 5% CO2 humidified atmosphere. On day 3, the culture medium was replaced with fresh medium.

Stimulation of DCs, Co-Cultures, and Labeling

After 6 days in culture, DCs were washed and suspended at a density of 1 x 106 cells/ml in serum-free media (RPMI 1640 medium). Cells stimulated or not with 100 ng of LPS were labeled with VIBRANT cell labeling solution DiO (3,3'-dioctadecyloxacarbocyanine perchlorate), and for co-culture conditions, either with DiO or with DiI (1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate) (Molecular Probes, Leiden, The Netherlands) for 10 minutes at 37??C and 5% CO2. After labeling, cells were washed three times with RPMI 1640 in 37??C prewarmed media and suspended in a collagen cell culture system (Chemicom, Hofheim, Germany). Cells were incubated at 37??C in 5% CO2, until they were analyzed by LSM.

Exovesicle Purification

Exovesicles were isolated using the standard process of a series of differential ultracentrifugation and filtration described previously.20,21 DCs cultured for 6 days were cultured in RPMI 1640 supplemented with 1% glutamine and 1% microvesicle-free human serum obtained by ultracentrifugation (110,000 x g) of the serum for 2 hours. DCs were stimulated or not with LPS (100 ng/ml) for 24 hours. The supernatant of 10 x 106 DCs was collected, and exovesicles were purified by centrifugation at 250 x g for 8 minutes as described previously20 and then run through 0.22-µm filters to eliminate large debris. The filtered supernatant was ultracentrifuged at 110,000 x g for 1 hour. Exovesicles were washed once with RPMI 1640 and pelleted by ultracentrifugation at 110,000 x g for 1 hour. Then the pellet was resuspended in 150 µl of RPMI 1640 media. The same media without cells following the same procedure of exovesicle isolation was used as control.

Lymphocyte Proliferation Assays

To perform mixed lymphocyte reactions (MLRs), 1 x 104 iDCs were co-cultured with 1 x 105 autologous lymphocytes with or without exovesicles purified from 10 x 106 autologous or heterologous pretreated DCs as described before. Co-cultures were done in triplicate in a final volume of 0.2 µl of RPMI, supplemented with 5% human serum and 2 mmol/L glutamine. The co-cultures were incubated for 6 days in a 5% CO2 atmosphere and proliferation was measured by the incorporation of methyl-thymidine (0.5 µCi/well), which was added to the co-culture for the last 18 hours.

Laser-Scanning Microscopy

For LSM analysis, a Zeiss LSM 510 Meta with an inverted Zeiss microscope (Axiovert 200M, lasers: HeNe 543 nm and Ar 488 nm; Carl Zeiss A.G., Feldbach, Switzerland) was used. Optical sections were taken with a 63x/1.4 Plan-Apochromat objective. This resulted in a voxel dimension of 0.1 x 0.1 x 0.25 µm in combination with a digital zoom. Image processing and visualization were done using IMARIS, a three-dimensional multichannel image processing software for LSM images (Bitplane AG, Zurich, Switzerland). To quantify the released exovesicles, the IsoSurface mode of the Surpass module in IMARIS was used, and an intensity threshold was applied to create a model of the data visualized as a solid surface. The cellular body and intracellular objects were removed manually before counting the number of extracellular objects. For this quantification, all microscope settings were kept constant during one experiment, ie, for control as well as treated cultures. All settings used for the image single restoration were also equal. The cells were chosen at random; the only criteria was that in the acquisition field an individual cell had to be present to avoid superposition of microvesicle structures from neighboring cells. Co-localization analysis was performed with the IMARIS co-localization module.

Processing of Cells for Transmission Electron Microscopy (TEM)

For TEM analysis of DCs stimulated or not with LPS, the cells were resuspended in complete culture medium containing 1.2% alginate.22 In the case of exovesicle characterization, the pellet of purified exovesicles was resuspended in complete culture medium containing 1.2% alginate. Drops of the media were suspended carefully in CaCl2 (50 mmol/L) solution for 1 hour to allow the matrix formation and DC immobilization. DCs or exovesicles in alginate drops were fixed in 2.5% phosphate-buffered glutaraldehyde solution, postfixed in 2% osmium tetroxide in 0.1 mol/L sodium cacodylate buffer, and contrasted in 0.5% uranyl acetate in 0.05 mol/L maleate buffer. This was followed by dehydration in a graded series of ethanol (70, 80, 96, and twice in 100%) and gradual replacement of ethanol by propylene oxide before the cells were infiltrated and embedded in epoxy resin. Ultrathin sections were cut using a Reichert Austria ultramicrotome and transferred onto 200-mesh uncoated copper grids, stained with uranyl acetate, counterstained with lead citrate according to standard methods,23 and finally observed with a Philips 300 TEM at 60 kV (FEI Company Philips Electron Optics, Zurich, Switzerland).

Data are expressed as mean values with the SEM. The statistical analysis was performed using SigmaStat for Windows (Version 3.10; Systat Software, Inc., or Excel for Windows) statistical software. Two groups were compared using Student??s t-test. P < 0.05 was considered significant.

Exovesicles from DCs Can Be Identified and Quantified by LSM

DC-secreted microvesicles were evidenced above all by transmission electron microscopy and quantified by Bradford analysis.24-26 To determine the dynamics of exovesicle release as well as identify their origin, we analyzed the release and quantification of exovesicles from blood monocyte-derived DCs. The cells were stained with DiO, a lipophilic fluorescent green probe, which is incorporated into the membrane lipid bilayers of living cells. The cells were cultured in a collagen matrix to immobilize the cells and visualize the released vesicles after LPS stimulation.

Cell image acquisition was done by LSM. To improve the visualization of the three-dimensional data set, shadow projection (IMARIS) from top (Figure 1A) or volume rendering from the side (Figure 1B) was performed. However, these visualization modes have not yet provided an identification of objects released from the cell body. Therefore, the cells were further analyzed using the IsoSurface mode of the Surpass module in IMARIS by applying a surface algorithm (Figure 1C) . The object was then segmented into individual objects, which separated the cell body from external objects, ie, the microvesicular structures (Figure 1D) . After removing the cell body as well as intracellular objects, the external objects could be visualized (Figure 1E) . Exovesicles were clearly detached from the DCs and were shown to be distinct from pseudopods. These exovesicles had a heterogeneous morphology and were different in size. Precise confocal data could be used for the analysis of these exovesicles, particularly for their quantification.

Figure 1. Visualization of individual objects by combining LSM and advanced digital image restoration. Cells were cultured in a collagen matrix to immobilize the cells and released vesicles after LPS stimulation for 24 hours. All images represent the same confocal data set taken from one cell. A: Three-dimensional reconstruction from top; B: volume rendering from the side; CCE: surface rendering from the cell (green), segmented into individual objects (cell body yellow, external objects turquoise).

DC Exovesicle Release Is Dependent on Danger Signals Such as LPS

The number of exovesicles released after 2, 6, and 24 hours in the matrix with or without LPS stimulation was quantified. In Figure 2A , exovesicles are shown surrounding the cells. In control cultures, the number of external objects increased transiently in a time-dependent manner, and the number increased up to three to four times when cells had been activated with LPS. The data are summarized in Figure 2B . Whereas iDCs released spontaneously 45 (SD, 25) to 120 (SD, 81) exovesicles per cell, the number of vesicles released by LPS-stimulated DCs was much higher, up to 247 (SD, 125) per cell after 24 hours of stimulation, with a peak value of 362 (SD, 128) at 6 hours. The diameter of these particles was between 0.1 and 5 µm, and 90% of them had a diameter between 0.2 and 0.4 µm (Figure 2C) . No significant difference in size was observed between unstimulated or LPS-stimulated in an early (6 hours) or late (24 hours) release exovesicles. This finding suggests that DCs are able to respond to danger signals by releasing exovesicles of different sizes, including those consistent with an endosomatic origin (exosomes from 0.05 to 0.09 µm), although most of them are larger exovesicles probably budding from the plasma membrane.

Figure 2. Visualization and quantification of released exovesicles. A: LSM images of iDC compared with LPS-maturated DCs after 2 (a, d), 6 (b, e), and 24 (c, f) hours. iDCs (aCc) and LPS-DCs (dCf), in collagen matrix, showing the release of exovesicles (turquoise vesicles) at different time points. B: Total amount of exovesicles released by DCs, calculated by the IMARIS software at the different time points, ie, 2, 6, and 24 hours. Data are expressed as mean ?? SD of two experiments with scanning of 8 to 10 cells each by LSM. The asterisk represents a statistically significant difference (P < 0.01) between LPS-treated and control groups. C: Size frequency of exovesicles, calculated by the Surpass module software in IMARIS, of DCs and LPS-stimulated DCs at 6 and 24 hours in the co-culture conditions. Bars are means ?? SD of nine data sets.

DCs Release Mostly Microvesicles Budding from the Cell Surface

TEM micrographs of DCs immobilized in alginate matrix display cells with the absence of apoptotic features such as DNA fragmentation or chromatin condensation and small spherical bodies (Figure 3A) surrounding cells. These microvesicles appear budding from the plasma membrane and to lay free, separated from the cells (inset A' and A'', arrows). After isolation of exovesicles by ultracentrifugation, the pellet was resuspended in the alginate matrix. We observed some of these exovesicles trapped in the matrix (Figure 3B) with different shapes. These exovesicles contained no prominent organelles and had a lipid bilayer cell membrane. We observed some material released by endosomal exocytosis, which might be related to the release of exosomes previously described.25,27 However, this form of microvesicles appeared to be insignificant. These results suggest that DCs are able to release many microvesicles, most of them budding from the surface or from the elongated processes of DCs. We consider this process as an exovesicle production, identical to that previously described.12,13

Figure 3. TEM of human DCs processed using alginate matrix. A: LPS-DCs cultivated for 6 hours in alginate matrix showing cell bodies and ruffling of the plasma membrane. In our TEM analysis, we confirm the absence of extensive apoptosis or apoptotic bodies. Insets A' and A'' show exovesicle (arrows) close to the cell. Inset A' shows details of exovesicle budding (arrowhead). B: Characterization of LPS-DC-derived exovesicles. Exovesicles from 10 x 106 LPS-DCs obtained after filtration and ultracentrifugation were resuspended in alginate. Different shapes of exovesicles are seen with a bilayer lipid membrane and suspended in the matrix.

Exovesicles Released from Stimulated DCs Can Fuse with the Cytoplasmic Membrane of Resting DCs in Co-Cultures

To test the ability of exovesicles to fuse with resting DCs in their vicinity, DCs were stimulated for 12 hours with 100 ng of LPS and stained with the fluorescent probe DiI (red) (LPS-DC). Prelabeled iDCs with the DiO (green) fluorescent probes were co-cultured with LPS-DCs in a collagen matrix. Cells were investigated after 6 and 24 hours, and the incorporation of the red fluorescence (LPS-DCs) in green labeled cells (iDCs) related to the cell volume was analyzed using the co-localization module in IMARIS.

When iDCs were co-cultured with control cells (no LPS stimulation), only a small amount of incorporated red material could be seen in green labeled cells, even if the cells were in close contact, as shown in Figure 4A . Conversely, when iDCs were co-cultured with stimulated LPS-DCs, at an early time (6 hours), nonstimulated DCs incorporated labeled vesicles into their membrane, as shown by the incorporation of red material (Figure 4B) . The number of co-localized voxels was analyzed. It resulted in 15.2 (SD, 9.4) co-localized voxels per µm3 for iDC co-cultures with LPS-DCs, compared with 5.2 (SD, 5.5) co-localized voxels per µm3 in control co-cultures (Figure 4B) . The number of co-localized voxels decreased after 24 hours and was 4.2 (SD, 5.3) voxels per µm3 for iDC co-cultures with LPS-DCs, compared with 1.4 (SD, 3.1) voxels per µm3 in control cultures (Figure 4B) . The rate of internalization of DC exovesicles was low compared with the fusion (Figure 4B) , which suggests that exovesicles lodged within the cell surface membrane probably play a role in antigen presentation.

Figure 4. Co-localization analysis of the incorporation of red-labeled exovesicles into green-labeled cells. Three-dimensional data of DiO-labeled iDCs (green) co-cultured with DiI-labeled LPS-treated DCs (red) in collagen matrix were taken with LSM and co-localization analysis was performed. A: Co-cultures of control cells (red and green). No red signal is seen in green cells. B: Exovesicles released from LPS-stimulated DCs fuse with the plasma membrane of iDCs, as shown by the incorporation of red material (yellow indicates co-localization of green and red, arrows). Little intracellular red material is seen (arrowhead). Images represent xy- and xz-projections; yellow arrowheads mark the position of projections. Insets represent three-dimensional reconstructions from the same data sets. C: Quantification of co-localized voxels related to the volume (µm3) in the plasma membrane of iDCs in the co-culture of nonstimulated DCs (iDC DiO C iDC DiI) or in the co-culture with LPS-stimulated DCs (iDC DiO C LPS-DC DiI). Data are expressed as mean ?? SD of three experiments with LSM scanning of 10 cells each. The asterisk represents a statistically significant difference (P < 0.02) between LPS-treated and control groups.

LPS-DCs Co-Cultured with Resting DCs Induce the Release of Exovesicles by Resting DCs

We examined the ability of iDCs to release exovesicles at 6 and 24 hours in the vicinity of DCs previously activated for 12 hours by LPS and washed or in contact with control DCs. Figure 5A shows one activated DC in co-culture for 24 hours with a nonactivated iDC. The iDC has incorporated red material (Figure 5A '). The release of external objects from such nonactivated iDCs which had fused with exovesicles was analyzed as described for directly stimulated DCs. Our results show that nonstimulated co-cultured DCs were able to release exovesicles very early on (Figure 5B) , with a mean of 7 (SD, 4) exovesicles during the first 6 hours and 88 (SD, 84) exovesicles after 24 hours. When resting DCs were co-cultured with LPS-matured DCs, the number of exovesicles increased from 21 (SD, 18) at 6 hours to 442 (SD, 276) at 24 hours. This suggests that, even though they were not directly stimulated with LPS, resting iDCs were able to sense a danger signal by fusing LPS-DCs exovesicles within their own membrane. They were then able to respond themselves by releasing a new burst of exovesicles, whereas LPS-DCs, after 24 hours, produced only very small numbers.

Figure 5. Release of exovesicles from iDCs in the vicinity of mDCs. A: LSM image of DiO-labeled iDCs (green) co-cultured with DiI-labeled LPS-stimulated DCs (red) in collagen matrix for 24 hours. In A', incorporated red material can be observed (arrows). A: Three-dimensional reconstruction; A': xy- and xz-projections from the same data set; yellow arrowheads mark the position of projections. B: Diagram showing total amount of external objects released by iDCs in the co-culture of nonstimulated DCs (left panels) or in the co-culture with LPS-stimulated DCs (right panels). Data are expressed as mean ?? SD of two experiments with LSM scanning of 8 to 10 cells each. The asterisk represents a statistically significant difference (P < 0.001) between LPS-treated and control groups.

Exovesicles from DCs Confer Alloantigen Presenting Capacity

Exovesicles may harbor molecules from the DCs from which they originated, among which there may be major histocompatibility antigens and co-stimulatory molecules.7 These exovesicles may thus confer antigen presentation capacity to the DCs with which they fused. To determine the functional role of these exovesicles released from DCs, exovesicles contained in culture supernatants of LPS-activated or nonactivated DCs were purified using the standard ultracentrifugation and filtration process described in Materials and Methods. For the MLR, DCs were co-cultured with syngeneic lymphocytes at a constant concentration with or without exovesicles from syngeneic or allogeneic DCs. Exovesicles from LPS-stimulated allo-iDCs were able to elicit T-cell proliferation after 6 days of incubation (Figure 6) . In five independent experiments, the intensity of T-cell stimulation was 3.5-times increased with exovesicles derived from allo-LPS-DCs than with exovesicles derived from allo-iDCs with a respective proliferation of 30,178 cpm (SEM ??13,273) compared with 8759 cpm (SEM ??4573) in the control condition (P < 0.05). In the experiment in which exovesicles derived from LPS-DCs were co-cultured with allogeneic lymphocytes without APCs, there was no significant induction of T-cell proliferation, indicating that DCs were required to induce alloantigen proliferation of T cells. In two control experiments, autologous MLR presentation (AMLR) was observed when syngeneic DCs and T cells were also incubated with syngeneic exovesicles from LPS-activated DCs. However, this AMLR reached 55% proliferation induced by allogeneic vesicles derived from LPS-stimulated DCs. One representative experiment with all controls is shown in Figure 6 .

Figure 6. Analysis of antigen-presenting function of DCs by exovesicles. MLR was used to assess the stimulatory function of exovesicles. DCs (DC1) were co-cultured with syngeneic lymphocytes (T1) at a constant concentration with or without exovesicles isolated from allogeneic pretreated DCs (DC2 and DC2-LPS) or syngeneic pretreated DCs (DC1 and DC1-LPS) as controls, as described in Materials and Methods. DC1/T1 cell ratio was 1:10. The co-cultures were incubated for 6 days and proliferation was measured by the incorporation of tritiated thymidine. One of five independent experiments, done in triplicate, is shown. Results are expressed as means ?? SD. One asterisk represents a statistically significant difference (P < 0.01) compared with T1 + DC1 + Exo (DC2) control conditions, and two asterisks represents a statistically significant difference (P < 0.05) compared with T1 + DC1 + Exo (DC1-LPS) control condition.

The major outcome of our work was to visualize and quantify for the first time the amount of exovesicles released per DC, particularly on LPS stimulation, using LSM in combination with advanced image restoration. With the Surpass module in IMARIS, we were able to quantify up to 900 exovesicles around stimulated cells. Various sizes were observed, with small vesicles of 0.05 µm as well as larger vesicles ranging from 0.1 to 1 µm, 90% of which ranging from 0.2 to 0.4 µm. However, there was no difference in size between vesicles released after 6 hours and after 24 hours of LPS or control conditions. Despite the fact that a variety of shapes was observed, the proportion of microvesicles with a size similar to that of exosomes (0.05 to 0.09 µm) was low (less than 5%), suggesting that exosomes could be released in smaller amounts than exovesicles. After labeling the cell membrane with DiO tracer, internalization of the labeled plasma membrane to form endosomes and then multivesicular endosomes was observed only occasionally. Therefore, we hypothesized that at least 90% of the microvesicles released were shed from the plasma membrane.

TEM was used to morphologically characterize DCs by the presence of elongated processes. As shown in Figure 3 , DCs were able to release microvesicles of various shapes and sizes, with a single membrane and a homogenous content. These exovesicles visualized by TEM originated from cells that did not have a dense nucleus, typical of cells undergoing apoptosis, and they were very few structures consistent with apoptotic bodies (<2%) of 1 to 4 µm in size.28

Nonactivated DCs release exovesicles in a process similar to the release of exosomes described in the literature.15 This is demonstrated by the constant increase in numbers released from an early time (2 hours) up to 24 hours. However, when DCs are activated, the release increases early on (2 hours) before reaching a peak at 6 hours (Figure 2B) . If we correlate these time points with the different stages of DC life, ie, recruitment, antigen uptake, and initial migration to lymph nodes, those exovesicles might be deemed to play a particular role in innate immune response and initial inflammation. Recently, MacKenzie and co-workers29 demonstrated that microvesicles from activated monocytes contain bioactive IL-1ß, which was able to stimulate IL-1 receptors on other cells. This supports our hypothesis that exovesicles might be involved in the early stages of inflammation.

Our finding that the number of exovesicles released from activated DCs is higher than that produced by resting DCs may contradict the results from other authors,24,30 who reported that the release of what they name exosomes decreases on maturation of DCs (mDCs), and that mDCs consistently secrete approximately two to three times less exosomes than iDCs, probably attributable to a reduction of endosomatic activity during maturation.15,24 However, besides the total amount released significantly higher at all time points with LPS-DCs than with iDCs, we observed special kinetics of the exovesicle release from LPS-DCs. The release peaked at 6 hours and decreased at 24 hours, showing that exovesicles as was demonstrated by exosomes24 can be developmentally regulated as a function of the maturation of DCs.

DCs were immobilized in a three-dimensional cell collagen culture system. In the co-culture system, we observed that microvesicular structures released from activated DCs can migrate and fuse with the membrane of resting DCs. This phenomenon was measured by counting the number of voxels in the membrane of resting DCs, which was high early on (6 hours) and decreased at 24 hours. This decrease may reflect the amount of vesicles available or a reduced capacity to integrate external material, which can be correlated with the maturation process of DCs fusing with microvesicles. Indeed, once the cells have integrated the exovesicles, they may be activated and lose some of their absorption capacity31 and enhance the turnover of their membrane component, thereby decreasing the visibility of the fused microvesicles on their surface. In addition, at the same time point, this matured cell increased its release of exovesicles as shown in Figure 5B . This supports the idea that exovesicles play a role as immunological messengers leading to the maturation/activation of neighboring DCs. This property could be linked with soluble or membrane-bound mediators as previously suggested29 or to the release of cytoplasmic components in the cells with which microvesicles did fuse.

The ability to prime naive T cells constitutes a unique and critical function of DCs. Despite this, exosomes have been shown to mediate transfer of membrane material between different cells, but it is not clear whether these microvesicles modulate T-cell tolerance or priming. Internalization of microvesicles has been demonstrated with a transfer of functional MHC class I to acceptor DCs for presentation to CD8+ T cells.32 In addition, exosomes from iDCs or mDCs display different qualitative protein composition.15

In our experiments, exovesicles released by allogeneic LPS-DCs transferred to resting DCs the capacity to prime T cells. We have shown that exovesicles were released as a function of danger signals; they could fuse with the membrane of resting DCs, transferring the capacity of matured cells to iDCs to present alloantigen to T cells. The microvesicular structures fused with iDCs might play a role in the activation of resting DCs but imply also the transfer of allo-MHC molecules and perhaps accessory molecules to allow MLR to be induced. Indeed, exovesicles isolated from LPS-stimulated autologous DCs are able to increase AMLR but at a rate still significantly lower than exovesicles isolated from allogeneic DCs, reflecting that this process is not a carryover of LPS but an increase of MHC on the DC surface. However, exovesicles released spontaneously by resting allogeneic or syngeneic DCs do not activate T cells. Our results corroborate the results of other authors, in which quiescent DCs were shown to help maintain a state of peripheral T-cell tolerance, as demonstrated by Shortman and Liu,33 thereby showing that exovesicles from resting DCs might contribute to tolerance. Furthermore, our experiments corroborate the fact that those vesicles do not present alloantigens to activate T cells but required the presence of DCs,34 thereby supporting the idea that these exovesicles are functionally very similar to exosomes and alone do not support T-cell proliferation.

In summary, the data generated by LSM and TEM provide new insights in the release of exovesicles from DCs. Overall, DCs are able to release numerous exovesicles from their plasma membrane in response to danger signals, a mechanism that appears to be much more prominent than the release of exosomes from multivesicular endosomes. Those exovesicles released from activated cells were integrated in the membrane of adjacent resting DCs, which in turn induced an activation and release of exovesicles from the plasma membrane. These exovesicles could transfer MHC molecules and antigens such as alloantigens to be presented by neighboring DCs to T cells.

We thank Denise Howald, Ursula Gerber, and Sandra Frank for their excellent technical assistance. We are also thankful to Marius Messerli, the owner of the Bitplane (Imaris/Surpass Software).

【参考文献】
  Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K: Immunobiology of dendritic cells. Annu Rev Immunol 2000, 18:767-811

Szakal AK, Kosco MH, Tew JG: A novel in vivo follicular dendritic cell-dependent iccosome-mediated mechanism for delivery of antigen to antigen-processing cells. Immunology 1988, 140:341-353

Tew JG, Kosco MH, Szakal AK: The alternative antigen pathway. Immunol Today 1989, 10:229-232

Cadigan KM: Regulating morphogen gradients in the Drosophila wing. Semin Cell Dev Biol 2002, 13:83-90

Heijnen HF, Schiel AE, Fijnheer R, Geuze HJ, Sixma JJ: Activated platelets release two types of membrane vesicles: microvesicles by surface shedding and exosomes derived from exocytosis of multivesicular bodies and alpha-granules. Blood 1999, 94:3791-3799

Taverna S, Ghersi G, Ginestra A, Rigogliuso S, Pecorella S, Alaimo G, Saladino F, Dolo V, Dell??Era P, Pavan A, Pizzolanti G, Mignatti P, Presta M, Vittorelli ML: Shedding of membrane vesicles mediates fibroblast growth factor-2 release from cells. J Biol Chem 2003, 278:51911-51919

Hugel B, Martinez MC, Kunzelmann C, Freyssinet JM: Membrane microparticles: two sides of the coin. Physiologist 2005, 20:22-27

West MA, Lucocq JM, Watts C: Antigen processing and class II MHC peptide-loading compartments in human B-lymphoblastoid cells. Nature 1994, 369:147-151

Th?ry C, Zitvogel L, Amigorena S: Exosomes: composition, biogenesis and function. Nat Rev Immunol 2002, 2:569-579

Dainiak N: Surface membrane-associated regulation of cell assembly, differentiation, and growth. Blood 1991, 78:264-276

Miguet L, Pacaud K, Felden C, Hugel B, Martinez MC, Freyssinet JM, Herbrecht R, Potier N, van Dorsselaer A, Mauvieux L: Proteomic analysis of malignant lymphocyte membrane microparticles using double ionization coverage optimization. Proteomics 2006, 6:153-171

Vittorelli ML: Shed membrane vesicles and clustering of membrane-bound proteolytic enzymes. Curr Top Dev Biol 2003, 54:411-432

Hägerstrand H, Isomaa B: Lipid and protein composition of exovesicles released from human erythrocytes following treatment with amphiphiles. Biochim Biophys Acta 1994, 1190:409-415

Taïeb J, Chaput N, Zitvogel L: Dendritic cell-derived exosomes as cell-free peptide-based vaccines. Crit Rev Immunol 2005, 25:215-223

Segura E, Amigorena S, Thery C: Mature dendritic cells secrete exosomes with strong ability to induce antigen-specific effector immune responses. Blood Cells Mol Dis 2005, 35:89-93

Obregon C, Dreher D, Kok M, Cochand L, Kiama GS, Nicod LP: Human alveolar macrophages infected by virulent bacteria expressing SipB are a major source of active interleukin-18. Infect Immun 2003, 71:4382-4388

Mentzer SJ, Guyre PM, Burakoff SJ, Faller DV: Spontaneous aggregation as a mechanism for human monocyte purification. Cell Immunol 1986, 101:312-319

Armant M, Rubio M, Delespesse G, Sarfati M: Soluble CD23 directly activates monocytes to contribute to the antigen-independent stimulation of resting T cells. J Immunol 1995, 155:4868-4875

Sallusto F, Lanzavecchia A: Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994, 179:1109-1118

Th?ry C, Boussac M, Veron P, Ricciardi-Castagnoli P, Raposo G, Garin J, Amigorena S: Proteomic analysis of dendritic cell-derived exosomes: a secreted subcellular compartment distinct from apoptotic vesicles. J Immunol 2001, 166:7309-7318

Raposo G, Nijman HW, Stoorvogel W, Liejendekker R, Harding CV, Melief CJ, Geuze HJ: B lymphocytes secrete antigen-presenting vesicles. J Exp Med 1996, 183:1161-1172

Page AM, Lagnado JR, Ford TW, Place G: Calcium alginate encapsulation of small specimens for transmission electron microscopy. J Microsc 1994, 175:166-170

Im Hof V, Scheuch G, Geiser M, Gebhart J, Gehr P, Heyder J: Techniques for the determination of particle deposition in lungs of hamsters. J Aerosol Med 1989, 2:247-259

Thery C, Regnault A, Garin J, Wolfers J, Zitvogel L, Ricciardi-Castagnoli P, Raposo G, Amigorena S: Molecular characterization of dendritic cell-derived exosomes. Selective accumulation of the heat shock protein hsc73. J Cell Biol 1999, 147:599-610

Pan BT, Teng K, Wu C, Adam M, Johnstone RM: Electron microscopic evidence for externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J Cell Biol 1985, 101:942-948

Wolfers J, Lozier A, Raposo G, Regnault A, Thery C, Masurier C, Flament C, Pouzieux S, Faure F, Tursz T, Angevin E, Amigorena S, Zitvogel L: Tumor-derived exosomes are a source of shared tumor rejection antigens for CTL cross-priming. Nat Med 2001, 7:297-303

Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C: Exosomal-like vesicles are present in human blood plasma. Int Immunol 2005, 17:879-887

Hristov M, Erl W, Linder S, Weber PC: Apoptotic bodies from endothelial cells enhance the number and initiate the differentiation of human endothelial progenitor cells in vitro. Blood 2004, 104:2761-2766

MacKenzie A, Wilson HL, Kiss-Toth E, Dower SK, North RA, Surprenant A: Rapid secretion of interleukin-1beta by microvesicle shedding. Immunity 2001, 15:825-835

Utsugi-Kobukai S, Fujimaki H, Hotta C, Nakazawa M, Minami M: MHC class I-mediated exogenous antigen presentation by exosomes secreted from immature and mature bone marrow derived dendritic cells. Immunol Lett 2003, 89:125-131

Morelli AE, Larregina AT, Shufesky WJ, Sullivan ML, Stolz DB, Papworth GD, Zahorchak AF, Logar AJ, Wang Z, Watkins SC, Falo LD, Jr, Thomson AW: Endocytosis, intracellular sorting, and processing of exosomes by dendritic cells. Blood 2004, 104:3257-3266

Andre F, Chaput N, Schartz NE, Flament C, Aubert N, Bernard J, Lemonnier F, Raposo G, Escudier B, Hsu DH, Tursz T, Amigorena S, Angevin E, Zitvogel L: Exosomes as potent cell-free peptide-based vaccine. I. Dendritic cell-derived exosomes transfer functional MHC class I/peptide complexes to dendritic cells. J Immunol 2004, 172:2126-2136

Shortman K, Liu YJ: Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002, 2:151-161

Th?ry C, Duban L, Segura E, Veron P, Lantz O, Amigorena S: Indirect activation of naive CD4+ T cells by dendritic cell-derived exosomes. Nat Immunol 2002, 3:1156-1162


作者单位:From the Department of Clinical Research,* Division of Pneumology, and the Institute of Anatomy, University of Bern, Bern, Switzerland; and the Department of Veterinary Anatomy and Physiology, University of Nairobi, Nairobi, Kenya

日期:2008年5月29日 - 来自[2006年第168卷第12期]栏目

Activation of Dendritic Cells through the Interleukin 1 Receptor 1 Is Critical for the Induction of Autoimmune Myocarditis

1 Medicine A, University Hospital, CH-4031 Basel, Switzerland
2 University Health Network, Departments of Medical Biophysics and Immunology, University of Toronto, Toronto, Ontario M5S 1A8, Canada
3 Department of Pathology, University Hospital, CH-8091 Zurich, Switzerland
4 IMBA, Institute for Molecular Biotechnology of the Austrian Academy of Sciences, A-1030 Vienna, Austria
5 Molecular Biomedicine, Swiss Federal Institute of Technology, CH-8952 Zurich, Switzerland


     Abstract

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Dilated cardiomyopathy, resulting from myocarditis, is the most common cause of heart failure in young patients. We here show that interleukin (IL)-1 receptor type 1–deficient (IL-1R1-/-) mice are protected from development of autoimmune myocarditis after immunization with -myosin-peptide(614–629). CD4+ T cells from immunized IL-1R1-/- mice proliferated poorly and failed to transfer disease after injection into naive severe combined immunodeficiency (SCID) mice. In vitro stimulation experiments suggested that the function of IL-1R1-/-CD4+ T cells was not intrinsically defect, but their activation by dendritic cells was impaired in IL-1R1-/- mice. Accordingly, production of tumor necrosis factor (TNF)-, IL-1, IL-6, and IL-12p70 was reduced in dendritic cells lacking the IL-1 receptor type 1. In fact, injection of immature, antigen-loaded IL-1R1+/+ but not IL-1R1-/- dendritic cells into IL-1R1-/- mice fully restored disease susceptibility by rendering IL-1R1-/- CD4+ T cells pathogenic. Thus, IL-1R1 triggering is required for efficient activation of dendritic cells, which is in turn a prerequisite for induction of autoreactive CD4+ T cells and autoimmunity.

 

Key Words: dendritic cells • interleukin 1 • interleukin 1 receptor type 1 • autoimmunity • myocarditis


     Introduction

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Idiopathic cardiomyopathy is the most common cause of heart failure in young patients. A growing body of evidence suggests that idiopathic cardiomyopathy may result from chronic myocarditis in predisposed individuals (13). Experimental autoimmune myocarditis (EAM) is a model for CD4+ T cell–mediated inflammatory heart disease and can be induced in mice by immunization with -myosin-heavy chain–derived peptides (46) together with CFA or CpG oligonucleotides. Proinflammatory cytokines like IL-12, IFN-, and TNF- are critically involved in the pathogenesis of autoimmune myocarditis. Whereas TNF- (7) and IL-12 (8, 9) are essential for the development of disease, IFN- protects by a mechanism that probably involves nitric oxide (10).

IL-1 is a multifunctional player during host defense and disease. It stimulates the acute phase response, the secretion of matrix metalloproteinases, chemokines, and other proinflammatory cytokines, acts as endogenous pyrogen, and activates lymphocytes (11, 12). In the context of autoimmunity, IL-1 promotes collagen-induced arthritis in mice (1315) and plays an important role in the pathogenesis of rheumatoid arthritis in humans (16). In fact, IL-1 antagonists are already used to treat patients with rheumatoid arthritis. IL-1 is produced by a variety of cell types including macrophages, B cells, T cells, and dendritic cells (DCs). Two forms of biologically active IL-1 exist, IL-1 and IL-1ß, which exert similar activities through the IL-1R type 1 (IL-1R1; CD121a). The IL-1R type 2 (IL-1R2; CD121b) is not considered to be involved in the signal transduction, but acts as a "decoy" receptor that can be shed from the cell surface and prevents IL-1 binding to the IL-1R type 1 (17). In addition, an endogenous IL-1R antagonist (IL-1ra) has been identified that binds to IL-1 receptors and blocks IL-1 binding and signaling (12).

The development of Coxsackie virus B3 (CVB3)-induced myocarditis is associated with the infiltration of the heart with inflammatory cells that secrete IL-1, and treatment with recombinant IL-1 enhances CVB3 myocarditis in partially resistant mice (18, 19). Furthermore, expression of IL-1R antagonist in the mouse heart by plasmid DNA decreases myocardial inflammation in CVB3 myocarditis (20). However, the role of IL-1 and the IL-1R1 during inflammatory heart disease has not been established on the genetic level. Our data provide the first in vivo evidence that IL-1R1 triggering on DCs is critical for expansion of autoreactive CD4+ T cells and subsequent induction of autoimmune heart disease.


     Materials and Methods

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Mice and Immunization Procedures.
IL-1R1-/- mutant mice (provided by M. Labow, Hoffmann-La Roche, Nutley, NJ; reference 21) were backcrossed into BALB/c background for more than eight generations in a specific pathogen free facility at the Basel Institute for Immunology. Wild-type BALB/c mice were purchased from Biological Research Laboratories Ltd. and SCID (BALB/c) mice from Taconics. Female mice in the age of 8–10 wk were immunized at days 0 and 7 with 50 µg of a murine specific -myosin-heavy chain–derived peptide (myhc- 614–629 [Ac-SLKLMATLFSTYASAD-OH]) in a 1:1 emulsion with CFA (1 mg/ml; H37Ra; Difco) (5) All experiments were in accordance with Swiss federal legislation and Canadian law and had been approved by the local authorities.

Histopathology and Immunohistochemistry.
21 d after the immunization, hearts were removed and processed for hematoxylin-eosin staining. Myocarditis was scored on a semiquantitative scale using grades from 0 to 4 (0: no inflammatory infiltrates; 1: small foci of inflammatory cells between myocytes; 2: larger foci of >100 inflammatory cells; 3: >10% of a cross section involved; 4: >30% of a cross section involved). For immunohistochemistry, OTC embedded frozen hearts were fixed in acetone and then processed for antibody staining according to standard protocols. The following antibodies were used: anti-MHC II (biotinylated; Serotec; MCA46B), anti-CD45R (RA3–6B2), anti-CD3 (KT3–1.1), anti-CD4 (YTS 191), anti-CD8 (YTS 169), anti-VCAM-1 mAb (0.5 mg/ml, clone 429; ), anti-ICAM-1 (20 mg/ml, clone 3E2; ); anti-Mac-1 (rat IgG, biotinylated), anti-CD11c (2.5 mg/ml, clone HL3; ), anti-Gr-1/Ly-6G (0.2 mg/ml, clone RB6–8C5; ).

Proliferation Assays.
CD4+ T cells were purified from draining lymph nodes of immunized mice using magnetic beads (CD4+ T cell isolation kit; Miltenyi Biotech) and cultured for 72 h together with irradiated (2,000 rad) syngenic splenocytes, with or without 10 µg/ml of myhc 614–634 in serum-free AIM-V/myhc(614–629) ( ) medium. Proliferation was assessed by measuring [3H]methyl-thymidine incorporation. IFN-, IL-2, IL-10, and IL-4 levels in supernatants were measured using commercially available ELISA kits (Quantikine; R&D Systems) after 40 h of culture in the presence of myhc-. For in vitro stimulation assays of primary CD4+ T cells, naive CD62L-positive CD4+ T cells were isolated from lymph nodes by depletion/positive selection with magnetic beads (CD4+ isolation kit, CD62L microbeads, MACS; Miltenyi Biotech). 105 CD4+ CD62L+ cells were then stimulated by 5 µg/ml soluble anti-CD3, 5 µg/ml anti-CD3 and 1 µg/ml anti-CD28, 50 ng/ml PMA and 500 ng/ml Ionomycin, or with 1 µg/ml Concanavalin A together with 0.25 x 105 irradiated (1,500 rad) purified nonstimulated DCs. Proliferative responses were assessed after 24 or 48 h in serum free AIM-V ( ) medium at 37°C/5% CO2 by measuring [3H]methyl-thymidine incorporation.

Generation of DCs, Cytokine Measurements, and FACS® Analysis.
DCs were generated as described (22). CD11c positive cells were further enriched by positive selection using magnetic beads (MACS; Miltenyi Biotech). Generally, FACS® analysis for CD11c expression and microscopic assessment of the typical cell morphology revealed over 80% of DCs. For cytokine measurements, DCs were plated at 106/ml in 24 well plates and incubated for 24 h with various stimuli including 5 µg/ml anti-CD40, 1 µg/ml LPS, 5 µg/ml anti-CD40, and 1 µg/ml LPS, 500 U/ml TNF-, or 10 ng/ml of IL-1ß. TNF-, IL-1ß, IL-12p70, and IL-6 were measured using Quantikine ELISA kits (R&D Systems). For FACS® analysis, DC preparations were preincubated for 30 min at 4° with Fc-block ( ) and 1% rat serum in staining buffer before incubation with the appropriate fluorochrome labeled antibodies from .

Adoptive Transfer of In Vitro–restimulated CD4+ T Cells and DC Treatment Protocol.
Spleens from donor mice were removed 21 d after the first immunization. CD4+ T cells were enriched using magnetic beads (MACS; Miltenyi Biotech) and cultured for 48 h on antigen pulsed and irradiated (1,500 rad) syngenic DCs. 5 x 106 CD4+ T cells per mouse (>98% CD4+ cells) were intraperitoneally injected in to SCID (IL-1R1+/+) mice. Recipients were killed 10 d after transfer, and myocarditis severity was assessed.

For in vivo reconstitution with antigen-pulsed DCs, we generated immature DCs by adding 20 ng/ml of IL-10 to the culture medium. 1 d prior to harvesting, cells were pulsed overnight with the myhc- peptide at 10 µg/ml. After enrichment of CD11c-positive cells using magnetic beads, 2 x 105 CD11c+MHC class IIlow+ DCs per mouse were intraperitoneally injected 6 h before immunization with myhc- and CFA on days 0 and 7.


     Results

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
IL-1R1-/- Mice Are Protected from Autoimmune Myocarditis.
To investigate the role of IL-1R1–mediated effects on the pathogenesis of murine autoimmune myocarditis, homozygous female IL-1R1-/- mice and IL-1R1+/+ controls on a BALB/c background were immunized with a peptide derived from mouse -myosin (myhc-). Disease prevalence and severity were assessed by histology and immunohistochemistry 21 d after the first immunization. IL-1R1+/+ mice developed severe cardiac inflammation. Inflammatory infiltrates mainly consisted of mononuclear cells including macrophages, CD4+ T cells, and CD8+ T cells, as well as some granulocytes and eosinophils () . In contrast, inflammatory infiltrates were absent in immunized IL-1R1-/- mice (). This effect was not dose dependent, because disease prevalence and severity did not increase in IL-1R1+/+ and IL-1R1-/- mice with higher antigen doses (data not depicted).


fig-ommitted Figure 1. IL-1R1-/- mice are protected from autoimmune myocarditis and rendered susceptible by transfer of IL-1R1+/+ DCs. (A and B) Mice were immunized with myhc- and hearts were evaluated at day 21. Inflammatory infiltrates are present in hearts of IL-1R1+/+ (A) but not IL-1R1-/- mice (B). (C and D) IL-1R1-/- mice were reconstituted with immature myhc-–pulsed bone marrow DCs derived from naive IL-1R1+/+ mice (wt-DC ko-mice) (C) or IL-1R1-/- mice (ko-DC ko-mice) (D) before immunization with myhc-. Myocarditis is seen in wt-DC  ko-mice (C) but not in ko-DC  ko-mice (D). (E and F) CD4+ T cells purified at day 21 after immunization of mice described in C and D were restimulated in vitro with myhc- for 48 h before transfer into naive IL-1R1+/+ SCID (BALB/c) recipients. At day 10 after adoptive transfer, unimmunized SCID mice develop myocarditis by transfer of IL-1R1-/- CD4+ T cells isolated from wt-DC  ko-mice (E) but not from ko-DC  ko-mice (F). 480x original magnification.

 

 

fig-ommitted Table I. Myocarditis Prevalence and Severity in IL-1R1+/+ and IL-1R1-/- Mice

 

 
Reduced Activation of Autoreactive CD4+ T Cells.
Autoimmune myocarditis is a CD4+ T cell mediated disease (6). To test the function of myosin-specific CD4+ T cells in immunized IL-1R1-/- mice, we purified CD4+ T cells from draining lymph nodes and restimulated them with the myhc- peptide on irradiated IL-1R1+/+ antigen-presenting cells in vitro. Compared with controls, self-specific CD4+ T cells from IL-1R1-/- mice proliferated poorly ( A), and produced little IL-2 and IFN-, whereas IL-4 and IL-10 production appeared to be intact ( B).


fig-ommitted
 
Figure 2. Reduced CD4+ T cell responses in immunized IL-1R1-/- mice. Groups of mice were immunized with myhc- and CD4+ T cells were isolated 21 d later and restimulated with 10 µg/ml myhc- in vitro. (A) Proliferation was measured by [3H]-thymidine incorporation after 48 h. Values indicate means (± SD) of three individual mice. *P = 0.036 for antigen restimulated IL-1R1-/- vs. IL-1R1+/+ CD4+ T cells (analysis of variance [ANOVA] and unpaired t test). (B) Cytokines in the supernatant were measured by ELISA after 40 h of restimulation with specific myhc- antigen. Values indicate means (± SD) of 4–5 individual mice. *P = 0.0037 for IL-2, and P < 0.0001 for IFN- production of IL-1R1-/- vs. IL-1R1+/+ CD4+ T cells. P values were calculated using ANOVA and the unpaired t test. (C) CD4+ CD62L+ T cells were purified from naive mice by MACS and stimulated with (i) soluble anti-CD3 (5 µg/ml), (ii) anti-CD3 (5 µg/ml) and anti-CD28 (1 µg/ml), (iii) PMA (50 ng/ml) and Ionomycin (500 ng/ml), or (iv) with Concanavalin A (1 µg/ml) together with 0.25 x 105 unstimulated DCs. Proliferation was measured after 48 h of culture with the indicated stimuli. *P < 0.0001 for both, IL-1R1+/+ and IL-1R1-/- DCs. P values were calculated using ANOVA and the unpaired t test. Values are expressed as mean (±SD) of five different mice. (D) Con A induced proliferation of IL-1R+/+CD4+ T cells on irradiated splenocytes (APC) in the presence of increasing numbers of either IL-1R1+/+ (black bars) or IL-1R1-/- (yellow bars) DCs. One out of four representative experiments is shown. Values are expressed as mean (±SD) of four culture wells.

 

 
To further investigate the function of autoimmune CD4+ T cells in vivo, we performed adoptive transfer experiments. CD4+ T cells from immunized IL-1R1-/- mice and IL-1R1+/+ controls were isolated at day 21, were expanded in vitro in the presence of specific antigen, and were injected into SCID mice. As shown previously (4), transfer of autoreactive CD4+ T cells from IL-1R1+/+ BALB/c mice resulted in myocarditis in SCID recipients (). In contrast, IL-1R1-/-CD4+ T cells did not induce any disease after adoptive transfer into SCID mice (). These data clearly confirm that autoimmune myocarditis can be induced by autoreactive CD4+ T cells and that the IL-1R1 is essential for their optimal activation in vivo. Given the impaired in vivo CD4+ T cell response in IL-1R1-/- mice, we asked whether the activation of CD4+ T cells intrinsically requires IL-1R1 signaling. To this end, we isolated naive CD62L+CD4+ T cells from healthy donor mice and triggered them for 24 or 48 h with various stimuli. As shown in  C, naive IL-1R1+/+ and IL-1R1-/-CD4+ T cells showed comparable proliferation upon stimulation with anti-CD3, anti-CD3/anti-CD28, PMA/Ionomycin, or Concanavalin A presented by wild-type DCs. Interestingly, both IL-1R1+/+ and IL-1R1-/-CD4+ T cells showed impaired proliferation upon Con A stimulation in the presence of DCs derived from IL-1R1-/- mice. However, IL-1R1-/- DCs do not suppress CD4+ T cell proliferation upon Con A in the presence of irradiated splenocytes. This is illustrated in  D, where increasing numbers of IL-1R1-/- DCs enhance IL-1R1+/+CD4+ T cell proliferation, albeit to a much lesser extent than IL-1R1+/+ DCs. Taken together, these data suggest that reduced CD4+ T cell activation in IL-1R1-/- mice immunized with self-peptide results from a defect at the level of DCs rather than from an intrinsic defect of CD4+ T cells in the absence of IL-1R1.


fig-ommitted Table II. Myocarditis Prevalence after Adoptive Transfer of In Vitro Antigen-restimulated CD4+ T Cells in SCID (Ad) Mutant Mice

 

 
Impaired Production of Proinflammatory Cytokines by IL-1R-/- DCs after In Vitro Stimulation.
To test whether the absence of the IL-1R1 on DCs affected their immune stimulatory capacity, we measured the expression of costimulatory molecules and the production of proinflammatory cytokines in response to various stimuli. Surface expression of MHC class II, CD40, ICAM-1, CD80, and CD86 differed only minimally on bone marrow–derived DCs (BM-DCs) from IL-1R1-/- and IL-1R1+/+ mice before and after (8 and 24 h) stimulation with either LPS, anti-CD40 mAb, or LPS/anti-CD40 mAb ( A). Furthermore, we did not observe any differences in the proportions of living and apoptotic CD11c+ BM-DCs in cell cultures after 24 h (not shown). Production of inflammatory cytokines including IL-6, TNF-, IL-1ß, and IL-12p70 by wild-type BM-DCs were considerably induced only after stimulation of Toll-like receptor (TLR)4 with LPS but not by stimulation with either anti-CD40, IL-1ß, or TNF-. Interestingly, stimulation of both TLR4 and CD40 further augmented production of IL-12p70 but not IL-6 and TNF-. As illustrated in  B, production of IL-6, TNF-, IL-1ß and, in particular, IL-12p70 was largely impaired in IL-1R1-/- DCs upon stimulation with LPS or LPS/anti-CD40. Preliminary data from our laboratory indicate that stimulation of TLR9 with CpG also resulted in impaired IL-12p70 production by IL-1R1-/- DCs (not shown). Coadministration of an anti–IL-1ß blocking antibody to DC cultures during stimulation inhibited production of proinflammatory cytokines by IL-1R1+/+ DCs similar than the IL-1R1 genetic defect () . Taken together our results suggest that triggering of the IL-1R1 is required for optimal activation of DCs to secrete proinflammatory cytokines including IL-12, which promote CD4+ activation.


fig-ommitted Figure 3. Up-regulation of costimulatory molecules and production of proinflammatory cytokines in IL-1R1+/+ and IL-1R1-/- DCs. (A) FACS® profiles representing only minimal differences in the expression of costimulatory molecules on IL-1R1+/+ (blue) and IL-1R1-/- (red) DCs before and after stimulation with LPS/anti-CD40 for 8 h. Histogramms were gated on CD11c+MHC class II+ live cells (ICAM, B7.1, B7.2) or CD11c+ live cells. (B) Mature BM-DCs were stimulated for 24 h as indicated. IL-12p70, TNF-, IL-6, and IL-1ß were measured by ELISA. Data for IL-1R1+/+ DCs (black bars) and IL-1R1-/- DCs (yellow bars) are expressed as mean (±SD) from quadruplicate culture wells. Differences between IL-1R1+/+ and IL-1R1-/- DCs were highly significant for all cytokines following LPS, or LPS/anti-CD40 stimulation. IL-1R1-/- DCs also produced significantly reduced levels of TNF-, IL-1ß, and IL-6 after stimulation with anti-CD40 alone, significantly reduced levels of IL-6 and IL-1ß after TNF- stimulation, and significantly reduced TNF- levels after IL-1ß stimulation. (All P values 0.0001 or <0.0001, following ANOVA and unpaired t test). The data are representative for several independent experiments with similar results.

 

 

fig-ommitted Figure 4. Neutralization of IL-1ß reduces production of proinflammatory cytokines by BM-DCs. Mature bone marrow–derived IL-1R1+/+ and IL-1R1-/- DCs were cultured for 24 h in the presence or absence of an anti–IL-1ß antibody. Cytokines were detected by ELISA. Data for CD40/LPS stimulated DCs (black bars) and nonstimulated DCs (yellow bars) are expressed as mean (±SD) from triplicate culture wells.

 

 
Injection of IL-1R1+/+ Antigen Pulsed DCs Restores Myocarditis Susceptibility of IL-1R1-/- Mice.
We next asked whether susceptibility to myocarditis could be restored in IL-1R1-/- mice by reconstitution with IL-1R1+/+ DCs. We grew immature BM-DCs in the presence of IL-10 to prevent activation and possibly tolerance induction (23) and pulsed them with myhc- before injection in IL-1R1-/- mice. Subsequently, mice were immunized with myhc-/CFA. Intriguingly, disease susceptibility was completely restored in IL-1R1-/-mice receiving IL-1R1+/+ DCs but not in those receiving IL-1R1-/- DCs (, and ), and histology of the hearts of DC reconstituted IL-1R1-/- mice was not different from diseased IL-1R1+/+ controls (). Importantly, disease severity in IL-1R1+/+ mice was not significantly reduced after injection of immature IL-1R1-/- DCs excluding a relevant tolerogenic role for IL-1R1-/- immature DCs in our experimental setting. Efficient in vivo priming of autoreactive T cells in IL-1R1-/- mice reconstituted with immature IL-1R1+/+ DCs was finally confirmed by the fact that CD4+ T cells isolated from these mice transferred disease upon injection into SCID (IL-1R1+/+) recipients (, and ). In conclusion, our data provide strong evidence that triggering of IL-1R1 on DCs is critical for induction of a pathogenic autoreactive CD4+ T cell response and development of autoimmune heart disease.


fig-ommitted Table III. Myocarditis Prevalence and Severity in Immunized IL-1R1+/+ and IL-1R1-/- Mice after Supplementation with Immature, myhc-–loaded DCs

 

 

     Discussion

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Our data demonstrate an essential role of the IL-1 pathway in the development of autoimmune inflammatory heart disease. Mice lacking the IL-1R1 were protected from myocarditis and showed impaired priming of heart myosin specific CD4+ T cells, which resulted from defective activation of DCs. To our knowledge, this is the first publication showing that inefficient DC activation prevents induction of autoimmune disease.

Members of the IL-1R/Toll-like receptor (TLR) superfamily including IL-1R1 and IL-18R commonly induce the signaling cascade MyD88 IRAK1/IRAK2  TRAF6 leading to the activation of the transcription factor nuclear factor (NF)-B, p38 mitogen-activated protein kinase (MAPK), and Jun-N terminal kinase. The NF-B pathway appears to play an important role in the development of autoimmune diseases and inactivation ameliorates EAE (24) and collagen-induced arthritis (25, 26), which has been implicated with the inhibition of Th1 responses. NF-B may promote the production of IFN- by T cells directly by interaction with a functional NF-B site in the IFN- promoter or by activation of p38 MAPK through regulation of GADD45ß in response to IL-18 (27). In our studies, we also observed reduced IFN- production by antigen-specific CD4+ T cells of immunized IL-1R1-/- mice. However, this does not provide a direct explanation for the protection from heart inflammation, because IFN--/- mice develop exacerbated myocarditis (810). On the other hand, IL-1 and NF-B activation has also been associated with the development of Th2 responses (2830), but we found that IL-4 and IL-10 production was unaffected after restimulation of CD4+ T cells from immunized IL-1R1-/- mice excluding immune deviation and the induction of IL-10+ regulatory T cells. Furthermore, Th2 cells do not play a crucial role in autoimmune myocarditis, although they can modulate the disease (8). Regardless whether IL-1 and NF-B regulate IFN- or IL-4 production in CD4+ T cells, our data clearly show that pathogenic CD4+ T cells in the IL-1R1-/- mice were fully activated and induced disease when they encountered IL-1R1+/+ DCs presenting the antigen. A normal Th1 and Th2 subset polarization was also observed when naive IL-1R1-/-CD4+ specific for OVA323–339 were stimulated with cognate antigen in the presence of wild-type DCs (unpublished data).

Transfer of immature BM-DCs from wild-type mice completely restored disease in IL-1R1-/- mice suggesting that DCs lacking the IL-1R1 are incapable to prime CD4+ T cells and induce autoimmunity. It is conceivable that IL-1 acts on DCs by stimulating their capacity to up-regulate CD40L and OX40 on CD4+ T cells (31). DCs might require IL-1R1 triggering for proper development, migration, antigen processing/presentation, or/and for optimal activation. In preliminary experiments, some of these possibilities were addressed. We purified CD11c+ DCs from lymph nodes and spleen of naive mice and analyzed them by flow cytometry. The frequency of CD8+ and CD8- DCs and the expression levels of MHC class II, CD86, and CD40 were comparable in IL-1R1+/+ and IL-1R1-/- mice indicating that DC development was not grossly affected (not shown). Our experiments using BM-DCs suggest that IL-1R1 triggering is required for production of a panel of pro-inflammatory cytokines including IL-12p70, IL-1, IL-6 and TNF-, which are all known to be targets of NF-B (32, 33). Reduced production of these cytokines was also observed when BM-DCs from wild-type mice were stimulated in the presence of neutralizing anti-IL-1ß mAb (). This finding is in keeping with results obtained with human DC subsets (34).

Interestingly, IL-1R1-/- DCs seem not to have a relevant defect to mature upon stimulation, as the up-regulation of CD80, CD86, and ICAM-1, the latter also activated by NF-B, was almost comparable to IL-1R1+/+ DCs.

Nevertheless, we cannot exclude that other DC functions such as their migratory capacity is reduced in the absence of IL-1R1 (35, 36). Regardless, the impaired production of TNF-, IL-6, and IL-12 itself may explain disease resistance of IL-1R1-/-mice, because each of them is indispensable for the induction of autoimmune myocarditis (7, 8, 37).

The phenotype of in vitro–activated IL-1R1-/- DCs appears somewhat reminiscent to the TNF-–induced semimature DCs described by Menges et al. (23), which showed impaired IL-12p70 production but normal up-regulation of costimulatory molecules upon stimulation. These semimature DCs were tolerogenic in a model of CD4+ T cell–mediated autoimmune disease. Despite the fact that injection of immature IL-1R1-/- DCs did not prevent disease in immunized IL-1R1+/+ mice, we cannot exclude a potential tolerogenic role for IL-1R-/- DCs because our experimental setting is different from the published tolerance induction protocol (23).

N. Rose and coworkers had shown that IL-1 treatment renders otherwise resistant mouse strains susceptible to viral myocarditis and suggested an important role for IL-1 and TNF- in up-regulation of adhesion molecules on endothelial cells (18). ICAM-1 expression has been shown to be critical for the recruitment of inflammatory cells in Coxsackie B3–induced myocarditis (38). Our data do not rule out a role for IL-1R1 signaling in endothelia activation or target organ homing of antigen-specific T cells. The fact that reconstitution with IL-1R1-/- DCs alone is sufficient in restoring myocarditis susceptibility and normal expression of endothelia activation markers in reconstituted IL-1R1-/-mice, suggest that IL-1R1–mediated mechanisms are either not decisive in mediating the access of autoreactive CD4+ T cells to the heart or may be compensated by redundant pathways.

Recently, it has been shown that structural proteins of several microorganisms potentially affecting the human heart show homology to the pathogenic -myosin peptide in BALB/c mice and to the human -myosin (39). Our findings contribute to the understanding of how DC activation may be initially modulated by microbial products in the absence of T cells and in the presence of innate signals. Indeed, the initial activation of DCs phagocyting debris and microbes containing potential self-peptide homologues might determine whether a pathogenic autoreactive response evolves or not. In this context, IL-1R1 signaling may play an important role bridging innate and adaptive immunity.

Taken together, our data show that IL-1R1 signaling induces autoimmunity by critically enhancing the capacity of antigen-presenting DCs to prime autoreactive T cells. Given the availability of clinically effective drugs targeting IL-1, our findings open new therapeutic perspectives in the treatment of inflammatory heart disease. Meanwhile, our data are a major step forward in understanding the mechanisms underlying autoimmunity and cardiac inflammation.


     Acknowledgments
 
This work was supported by grants from the Swiss National Foundation, grant no. 3200-067197, and by the Swiss Heart Foundation. Urs Eriksson is supported by the Swiss Foundation for Medical-Biological Grants and the Novartis Foundation.

Submitted: October 9, 2002
Revised: December 11, 2002
Accepted: December 16, 2002


     References

日期:2007年5月18日 - 来自[2003年第162卷第3期]栏目

Vaginal Submucosal Dendritic Cells but Not Langerhans Cells Induce Protective Th1 Responses to Herpes Simplex Virus-2

1 Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, CT 06520
2 Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA 02115


Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

  1. Martino, T.A., P. Liu, and M.J. Sole. 1994. Viral infection and the pathogenesis of dilated cardiomyopathy. Circ. Res. 74:182–188.

  2. Batra, A.S., and A.B. Lewis. 2001. Acute myocarditis. Curr. Opin. Pediatr. 13:234–239.

  3. D'Ambrosio, A., G. Patti, A. Manzoli, G. Sinagra, A. Di Lenarda, F. Silvestri, and G. Di Sciascio. 2001. The fate of acute myocarditis between spontaneous improvement and evolution to dilated cardiomyopathy: a review. Heart. 85:499–504.

  4. Smith, S.C., and P.M. Allen. 1991. Myosin-induced acute myocarditis is a T cell-mediated disease. J. Immunol. 147:2141–2147.

  5. Pummerer, C.L., K. Luze, G. Grassl, K. Bachmaier, F. Offner, S.K. Burrell, D.M. Lenz, T.J. Zamborelli, J.M. Penninger, and N. Neu. 1996. Identification of cardiac myosin peptides capable of inducing autoimmune myocarditis in BALB/c mice. J. Clin. Invest. 97:2057–2062.

  6. Penninger, J.M., N. Neu, E. Timms, V.A. Wallace, D.R. Koh, K. Kishihara, C. Pummerer, and T.W. Mak. 1993. The induction of experimental autoimmune myocarditis in mice lacking CD4 or CD8 molecules. J. Exp. Med. 178:1837–1842.

  7. Bachmaier, K., C. Pummerer, I. Kozieradzki, K. Pfeffer, T.W. Mak, N. Neu, and J.M. Penninger. 1997. Low-molecular-weight tumor necrosis factor receptor p55 controls induction of autoimmune heart disease. Circulation. 95:655–661.

  8. Eriksson, U., M.O. Kurrer, W. Sebald, F. Brombacher, and M. Kopf. 2001. Dual role of the IL-12/IFN-gamma axis in the development of autoimmune myocarditis: induction by IL-12 and protection by IFN-gamma. J. Immunol. 167:5464–5469.

  9. Afanasyeva, M., Y. Wang, Z. Kaya, E.A. Stafford, K.M. Dohmen, A.A. Sadighi Akha, and N.R. Rose. 2001. Interleukin-12 receptor/STAT4 signaling is required for the development of autoimmune myocarditis in mice by an interferon-gamma-independent pathway. Circulation. 104:3145–3151.

  10. Eriksson, U., M.O. Kurrer, R. Bingisser, H.P. Eugster, P. Saremaslani, F. Follath, S. Marsch, and U. Widmer. 2001. Lethal autoimmune myocarditis in interferon-gamma receptor-deficient mice: enhanced disease severity by impaired inducible nitric oxide synthase induction. Circulation. 103:18–21.

  11. Dinarello, C.A. 1996. Biologic basis for interleukin-1 in disease. Blood. 87:2095–2147.

  12. Dinarello, C.A. 1998. Interleukin-1, interleukin-1 receptors and interleukin-1 receptor antagonist. Int. Rev. Immunol. 16:457–499.

  13. Bessis, N., L. Guery, A. Mantovani, A. Vecchi, J.E. Sims, D. Fradelizi, and M.C. Boissier. 2000. The type II decoy receptor of IL-1 inhibits murine collagen-induced arthritis. Eur. J. Immunol. 30:867–875.

  14. Joosten, L.A., M.M. Helsen, T. Saxne, F.A. van De Loo, D. Heinegard, and W.B. van Den Berg. 1999. IL-1 alpha beta blockade prevents cartilage and bone destruction in murine type II collagen-induced arthritis, whereas TNF-alpha blockade only ameliorates joint inflammation. J. Immunol. 163:5049–5055.

  15. Iwakura, Y. 2002. Roles of IL-1 in the development of rheumatoid arthritis: consideration from mouse models. Cytokine Growth Factor Rev. 13:341–355.

  16. O'Neill, L. 2001. IL-1 versus TNF in arthritis? Trends Immunol. 22:353–354.

  17. Re, F., M. Sironi, M. Muzio, C. Matteucci, M. Introna, S. Orlando, G. Penton-Rol, S.K. Dower, J.E. Sims, F. Colotta, and A. Mantovani. 1996. Inhibition of interleukin-1 responsiveness by type II receptor gene transfer: a surface "receptor" with anti-interleukin-1 function. J. Exp. Med. 183:1841–1850.

  18. Lane, J.R., D.A. Neumann, A. Lafond-Walker, A. Herskowitz, and N.R. Rose. 1992. Interleukin 1 or tumor necrosis factor can promote Coxsackie B3-induced myocarditis in resistant B10.A mice. J. Exp. Med. 175:1123–1129.

  19. Lane, J.R., D.A. Neumann, A. Lafond-Walker, A. Herskowitz, and N.R. Rose. 1993. Role of IL-1 and tumor necrosis factor in coxsackie virus-induced autoimmune myocarditis. J. Immunol. 151:1682–1690.

  20. Lim, B.K., S.C. Choe, J.O. Shin, S.H. Ho, J.M. Kim, S.S. Yu, S. Kim and E.S. Jeon. 2002. Local expression of interleukin-1 receptor antagonist by plasmid DNA improves mortality and decreases myocardial inflammation in experimental coxsackieviral myocarditis. Circulation. 105:1278–1281.

  21. Labow, M., D. Shuster, M. Zetterstrom, P. Nunes, R. Terry, E.B. Cullinan, T. Bartfai, C. Solorzano, L.L. Moldawer, R. Chizzonite, and K.W. McIntyre. 1997. Absence of IL-1 signaling and reduced inflammatory response in IL-1 type I receptor-deficient mice. J. Immunol. 159:2452–2461.

  22. Lutz, M.B., N. Kukutsch, A.L. Ogilvie, S. Rossner, F. Koch, N. Romani, and G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods. 223:77–92.

  23. Menges, M., S. Rossner, C. Voigtlander, H. Schindler, N.A. Kukutsch, C. Bogdan, K. Erb, G. Schuler, and M.B. Lutz. 2002. Repetitive injections of dendritic cells matured with tumor necrosis factor alpha induce antigen-specific protection of mice from autoimmunity. J. Exp. Med. 195:15–21.

  24. Hilliard, B., E.B. Samoilova, T.S. Liu, A. Rostami, and Y. Chen. 1999. Experimental autoimmune encephalomyelitis in NF-kappa B-deficient mice:roles of NF-kappa B in the activation and differentiation of autoreactive T cells. J. Immunol. 163:2937–2943.

  25. Gerlag, D.M., L. Ransone, P.P. Tak, Z. Han, M. Palanki, M.S. Barbosa, D. Boyle, A.M. Manning, and G.S. Firestein. 2000. The effect of a T cell-specific NF-kappa B inhibitor on in vitro cytokine production and collagen-induced arthritis. J. Immunol. 165:1652–1658.

  26. Seetharaman, R., A.L. Mora, G. Nabozny, M. Boothby, and J. Chen. 1999. Essential role of T cell NF-kappa B activation in collagen-induced arthritis. J. Immunol. 163:1577–1583.

  27. Yang, J., H. Zhu, T.L. Murphy, W. Ouyang, and K.M. Murphy. 2001. IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-gamma production. Nat. Immunol. 2:157–164.

  28. McKean, D.J., R.P. Podzorski, M.P. Bell, A.E. Nilson, C.J. Huntoon, J. Slack, S.K. Dower, and J. Sims. 1993. Murine T helper cell-2 lymphocytes express type I and type II IL-1 receptors, but only the type I receptor mediates costimulatory activity. J. Immunol. 151:3500–3510.

  29. al-Ramadi, B.K., T. Welte, M.J. Fernandez-Cabezudo, S. Galadari, B. Dittel, X.Y. Fu, and A.L. Bothwell. 2001. The Src-protein tyrosine kinase Lck is required for IL-1-mediated costimulatory signaling in Th2 cells. J. Immunol. 167:6827–6833.

  30. Yang, L., L. Cohn, D.H. Zhang, R. Homer, A. Ray, and P. Ray. 1998. Essential role of nuclear factor kappaB in the induction of eosinophilia in allergic airway inflammation. J. Exp. Med. 188:1739–1750.

  31. Nakae, S., M. Asano, R. Horai, N. Sakaguchi, and Y. Iwakura. 2001. IL-1 enhances T cell-dependent antibody production through induction of CD40 ligand and OX40 on T cells. J. Immunol. 167:90–97.

  32. Yoshimoto, T., H. Nagase, T. Ishida, J. Inoue, and H. Nariuchi. 1997. Induction of interleukin-12 p40 transcript by CD40 ligation via activation of nuclear factor-kappaB. Eur. J. Immunol. 27:3461–3470.

  33. O'Neill, L.A., and C.A. Dinarello. 2000. The IL-1 receptor/toll-like receptor superfamily: crucial receptors for inflammation and host defense. Immunol. Today. 21:206–209.

  34. Luft, T., M. Jefford, P. Luetjens, H. Hochrein, K.A. Masterman, C. Maliszewski, K. Shortman, J. Cebon, and E. Maraskovsky. 2002. IL-1 beta enhances CD40 ligand-mediated cytokine secretion by human dendritic cells (DC): a mechanism for T cell-independent DC activation. J. Immunol. 168:713–722.

  35. Stoitzner, P., M. Zanella, U. Ortner, M. Lukas, A. Tagwerker, K. Janke, M.B. Lutz, G. Schuler, B. Echtenacher, B. Ryffel, et al. 1999. Migration of langerhans cells and dermal dendritic cells in skin organ cultures: augmentation by TNF-alpha and IL-1beta. J. Leukoc. Biol. 66:462–470.

  36. Cumberbatch, M., R.J. Dearman, R.W. Groves, C. Antonopoulos, and I. Kimber. 2002. Differential regulation of epidermal langerhans cell migration by interleukins (IL)-1alpha and IL-1beta during irritant- and allergen-induced cutaneous immune responses. Toxicol. Appl. Pharmacol. 182:126–135.

  37. Eriksson, U., M.O. Kurrer, N. Schmitz, S.C. Marsch, A. Fontana, H.P. Eugster, and M. Kopf. 2002. IL-6-deficient mice resist development of autoimmune myocarditis associated with impaired activation of autoreactive CD4+-T cells and upregulation of complement C3. Circulation. In press.

  38. Seko, Y., H. Matsuda, K. Kato, Y. Hashimoto, H. Yagita, K. Okumura, and Y. Yazaki. 1993. Expression of intercellular adhesion molecule-1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J. Clin. Invest. 91:1327–1336.

  39. Bachmaier, K., N. Neu, L.M. de la Maza, S. Pal, A. Hessel, and J.M. Penninger. 1999. Chlamydia infections and heart disease linked through antigenic mimicry. Science. 283:1335–1339.

     Abstract

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Herpes simplex virus (HSV) type 2 infection occurs primarily at the genital mucosal surfaces and is a leading cause of ulcerative lesions. Despite the availability of animal models for HSV-2 infection, little is known regarding the mechanism of immune induction within the vaginal mucosa. Here, we examined the cell types responsible for the initiation of protective Th1 immunity to HSV-2. Intravaginal inoculation of HSV-2 led to a rapid recruitment of submucosal dendritic cells (DCs) to the infected epithelium. Subsequently, CD11c+ DCs harboring viral peptides in the context of MHC class II molecules emerged in the draining lymph nodes and were found to be responsible for the stimulation of IFN secretion from HSV-specific CD4+ T cells. Other antigen-presenting cells including B cells and macrophages did not present viral peptides to T cells in the draining lymph nodes. Next, we assessed the relative contribution to immune generation by the Langerhans cells in the vaginal epithelium, the submucosal CD11b+ DCs, and the CD8+ lymph node DCs. Analysis of these DC populations from the draining lymph nodes revealed that only the CD11b+ submucosal DCs, but not Langerhans cell–derived or CD8+ DCs, presented viral antigens to CD4+ T cells and induced IFN secretion. These results demonstrate a previously unanticipated role for submucosal DCs in the generation of protective Th1 immune responses to HSV-2 in the vaginal mucosa, and suggest their importance in immunity to other sexually transmitted diseases.

 

Key Words: genital mucosa • cytokines • lymph node • epithelium • sexually transmitted disease


     Introduction

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
The vaginal mucosa is under constant exposure to infectious agents, and is consequently surveyed by a network of dendritic cells (DCs). DCs are present in both the stratified squamous epithelial layer as Langerhans cells (LCs) and in the submucosal lamina propria in the vagina. Although a similar population of the latter found in the skin, known as the dermal DCs, has been shown to possess similar immunostimulatory capacity to epidermal LCs in vitro (1, 2), virtually nothing is known about the role of submucosal vaginal DCs in the induction of mucosal immunity. Unlike other mucosal tissues, the female reproductive tract undergoes dramatic hormone-dependent changes over the course of the menstrual cycle. Previous studies have shown that mice are susceptible to intravaginal (ivag) herpes simplex virus (HSV) type 2 infection only during the catabolic metestrous-2 and the diestrous phases of the estrous cycle (36). Thus, treatment of mice with progesterone (Depo-Provera®), which maintains the mice at the diestrous-like stage, is often required for consistent ivag infection with HSV-2. However, the precise mechanism by which the progesterone treatment increases the susceptibility to ivag HSV-2 infection is unknown. One potential mechanism relates to the thickness of the vaginal epithelial layer. With the increase in serum estrogen levels, the epithelial cell layer thickens during the estrous stage. Subsequently, with the increase in the progesterone levels and decrease in the estrogen, the superficial layers of the vaginal epithelium are delaminated during metestrous phases and become maximally thin by the diestrous stage. Another possible mechanism for the increased susceptibility to HSV-2 ivag infection in progesterone-dominant mice is the lack of antigen-presenting cells (APCs) at the sites of infection required to initiate immune responses, as frequency of LCs may differ at each stage of the menstrual cycle within the mouse vagina. Thus, it is important to determine the distribution and function of DCs during the estrous cycle, as it relates to the susceptibility of the female host to infectious agents such as HSV-2.

A mouse model of ivag infection using HSV-2 thymidine kinase (TK) mutant strain (6, 7) has provided important insights into the mechanism of immune resistance to HSV-2. The TK- mutant HSV-2 causes mild vaginal pathologies that resolve within 7 d but do not result in neurologic diseases, making it an ideal virus with which to study immune induction to vaginal HSV-2 infection. Intravaginal infection with TK- HSV-2 is known to induce protective immunity that is primarily mediated by IFN-secreted from CD4+ T cells (8, 9) and HSV-2–specific IgG (10, 11). However, the viral infection events and APC types involved in inducing the T cell responses to HSV-2 are poorly understood. A recent paper has demonstrated that B cells represent the major cell type recruited from the vaginal mucosa to the draining lymph nodes after ivag HSV-2 delivery, suggesting a role for B cells in the immune initiation process (12). In this paper, no migration of LCs from the vagina to the draining lymph nodes was detected, raising the question about whether LCs are involved in antigen presentation and T cell activation in the draining lymph nodes.

To understand the mechanism of immune induction by DCs and other APCs to HSV-2 infection in the vaginal mucosa, we examined the distribution, phenotype, and function of DCs at the sites of infection and in the draining lymph nodes. By following HSV-2 infection and DC distribution by immunofluorescence microscopy, we demonstrate that HSV-2 productively infects the vaginal epithelium exclusively and that submucosal DCs are recruited to the lamina propria bordering the infected epithelium within 24 h after infection (a.i.). In addition, we present the time course of the appearance of DCs harboring HSV-2 peptides in the draining lymph nodes, the induction of HSV-2–specific CD4+ T cell responses in the local draining lymph nodes and the subsequent migration of these primed T cells to systemic lymphoid organs. Furthermore, by isolating specifically the LCs and submucosal DCs from the draining lymph nodes, we demonstrate that the primary cells that migrate from the vaginal mucosa and present viral antigens to CD4+ T cells are non-LC submucosal DCs. The results from this paper provide the first evidence that DCs are recruited rapidly to the lamina propria bordering the infected vaginal epithelial cells infected with HSV-2, and that these CD11c+/CD11b+ submucosal DCs, but not LCs or CD8+ DCs, B cells, or other APCs, phagocytose viral antigens and migrate to local lymph nodes to induce protective Th1 CD4+ T cell responses.


     Materials and Methods

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Virus.
HSV-2 strains 186TKKpn were constructed as described previously (13) and propagated and assayed on Vero cells (14). All stocks were titered on the Vero cell line before use in the ivag infections.

Animals and HSV-2 Infection.
6–8-wk-old female BALB/c mice were obtained from the National Cancer Institute. Mice transgenic for TCR that recognizes OVA323–339 peptide in the context of I-Ad (DO11.10TCR-ß transgenic mice) on a BALB/c background were provided by Dr. Dennis Loh (Washington University, St. Louis, MO). The estrous stage of mice was determined from analysis of vaginal smears taken by a calcium-alginate swab ( ) and stained with Diff-Quik Stain (Dade Behring) according to manufacturer's instruction. Stained cells were carefully examined and the estrous stage of each mouse was identified as diestrous, estrous, metestrous-1, or metestrous-2 according to a previously established protocol (15, 16). For virus infection studies, mice were injected subcutaneously in the neck ruff with Depo-Provera® (Pharmacia & Upjohn Diagnostics) at 2 mg/mouse in 100-µl volume 5–7 d before infection, swabbed with calcium-alginate and inoculated ivag with either 107 PFU of HSV-2 strain 186TKKpn or inoculated with noninfected Vero cell lysate (mock infection) in 10 µl volumes using a blunt-ended micropipette tip. All procedures used in this paper complied with federal guidelines and institutional policies by the Yale Animal Care and Use Committee.

Antibodies.
The following antibodies were used for the identification of cell populations: anti-CD11c (N418), anti-CD11b (M1/70), anti-CD8 (53-6.7), anti-DEC205 (NLDC-145), and anti–MHC class II (M5/114). The aforementioned antibodies were purchased from , except for NLDC-145 and N418 which were purified from hybridoma supernatants. The LC-specific anti-gp40 antibody G8.8 developed by Andrew Farr (University of Washington, Seattle, WA), was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa Department of Biological Sciences. For localization of HSV-2–infected cells, polyclonal rabbit antiserum against HSV-2 was purchased from BioGenex.

Double Immunofluorescence Staining of Vaginal Tissues.
To examine the distribution of DC in relation to HSV-2 infection within the vagina, frozen sections of vagina were stained with a variety of antibodies in a procedure similar to that described previously (17) with minor modifications. In brief, 6–8-µm frozen sections were fixed in acetone and blocked with TNB buffer (3% Casein in PBS; ) containing 5% normal donkey serum. To block endogenous biotin, the sections were further treated with the Avidin–Biotin block ( ), and endogenous peroxidase activity was quenched with 1% H2O2. The primary antibody was applied at 5 µg/ml for 1.5 h at room temperature. Slides were washed and incubated with biotin-conjugated donkey F(ab')2 anti–hamster IgG ( , Inc.), followed by incubation with streptavidin–HRP conjugate ( ). The antigens were detected using tyramide-FITC (   Inc.) according to the manufacturer's instructions. After the development with the first antibody, sections were blocked with Avidin–Biotin, followed by incubation with 2% H2O2. The sections were subsequently stained with the second primary antibody in a similar manner as described above in the previous paragraph with proper species-specific secondary antibody. The slides were developed with tyramide-tetramethylrhodamine ( ). At the end of the staining, slides were washed and incubated with DAPI (Molecular Probes) and mounted with Fluoromount-G ( ). The stained slides were analyzed by fluorescence microscopy (Leitz Orthoplan 2) with a 20x objective lens or by confocal microscopy using a confocal laser microscope (model LSM510; Carl Zeiss MicroImaging, Inc.) with a 20 or 40x objective lens with water.

Preparation of Dendritic Cells and Other APCs.
DCs and other APCs were prepared from draining lymph nodes of ivag HSV-2–infected mice as described previously (18). In brief, draining lymph nodes (inguinal and iliac), or in some cases spleen and mesenteric lymph nodes, were excised from infected mice at various time points. Lymph nodes were digested with collagenase D and DNase I and incubated in the presence of 5 mM EDTA at 37°C for 5 min. A single-cell suspension was prepared, and cells were incubated with anti–mouse CD11c-coated magnetic beads (Miltenyi Biotech) and selected on MACS separation columns twice. Positively selected cells were routinely 80–90% DC based on CD11c and MHC class II staining by flow cytometry. For CD11c-depleted B cells and MHC class II+ cells, CD11c+ cells were depleted from the draining lymph node suspension by labeling CD11c+ cells with the MACS separation beads (anti-CD11c–coated beads) followed by selection using the LD depletion column (Miltenyi Biotech). B220+ or I-Ad+ cells were obtained from CD11c-depleted population by staining with FITC-conjugated B220 or FITC-conjugated anti–MHC class II antibody and selected on anti-FITC–conjugated MACS beads according to the manufacturer's instructions (Miltenyi Biotech). The B220+- and I-Ad+–selected cells were routinely 80–90% pure as determined by FACS® (see  a). To prepare activated DCs for experiments described in  e, transiently adherent DCs were prepared from splenocytes of BALB/c mice as described previously (19). For FACS® sorting of LCs and submucosal DCs, CD11c-enriched cells from the draining lymph nodes were stained with anti-gp40 (rat IgG2a) followed by FITC-conjugated anti–rat Fab ( ). Cells were washed extensively and stained with anti-CD11b and anti-CD11c. The submucosal DCs (CD11b+/gp40-/CD11c+) and LCs (CD11c+/gp40+) were sorted to 99% purity. In separate experiments, CD8+ and CD11b+ DCs were isolated from the draining lymph nodes after staining of CD11c-enriched population with antibodies to CD8, CD11b, and CD11c. The CD8+ DCs (CD8+/CD11c+/CD11b-) and CD11b+ DCs (CD11b+/CD11c+/CD8-) were FACS®-sorted to 99% purity.


fig-ommitted
 
Figure 4. CD11c+ DCs are crucial for IFN secretion from HSV-2–specific T cells. Various APC populations were isolated from draining lymph nodes of day 5 infected mice by magnetic selection. CD11c- fraction was obtained using the depletion column and was further subdivided into B220+ or I-Ad+ groups by magnetic selection. (a) A representative FACS® profile of these APC populations, gated on live cells, is shown. These APC groups were used to stimulate HSV-2–specific CD4+ T cells in the absence (b and c) or presence (d and e) of exogenously added heat-inactivated virus. Cytokines secreted from T cells were measured by ELISA. The data are representative of three similar experiments. Each experiment was conducted with three to four mice.

 

 

fig-ommitted Figure 3. DCs in the draining lymph nodes up-regulate co-stimulatory molecules and present viral antigen. DCs were isolated from the draining lymph nodes of mice inoculated ivag with HSV-2 or with control cell lysate (mock) using magnetic beads. (a) Co-stimulatory molecules CD80 and CD86 expression levels were determined by flow cytometry. (b–d) Cytokine secretion from HSV-2–specific CD4+ T cells co-cultured with draining lymph node DCs, or from CD4+ T cells (day 5 a.i.) or DCs (day 3 a.i.) alone, were analyzed by ELISA. CD4+ HSV-2–specific T cells were obtained from the draining lymph node of day 5 ivag HSV-2–infected mice by positive selection using magnetic selection. To demonstrate the antigen specificity of the T cell responses, (e) DCs isolated from the draining lymph nodes of either mock-infected or day 3 HSV-2–infected mice, or in vitro–activated transiently adherent splenic DCs, were coincubated with day 5 draining lymph node CD4+ T cells in the presence (filled) or absence (white) of exogenously added virus antigens. T cell IFN secretion was measured by ELISA. (f) To demonstrate the requirement of specific antigen for T cell activation by the draining lymph node DCs, in vitro–activated OVA-specific T cells were coincubated with DCs isolated from the draining lymph nodes of either mock-infected or day 4 HSV-2–infected mice in the presence (filled) or absence (white) of OVA323–339 peptide. T cell IFN secretion was measured by ELISA.

 

 
Isolation of CD4+ T Cells.
Draining lymph nodes (inguinal and iliac) were excised from infected mice at the indicated time points. Single-cell suspensions of lymph node cells were made by dissociating cells through the cell strainer. Cells were washed twice with PBS, stained with FITC-conjugated anti-CD4 antibody ( ), and selected with magnetic beads conjugated to anti-FITC antibody (Miltenyi Biotech) according to the manufacturer's instructions. Selected cells were checked by flow cytometry and were routinely 90–95% pure CD4+ T cells. For experiments involving ovalbumin-specific T cells ( f), in vitro–activated CD4+ T cells were prepared by incubating total splenocytes from DO11.10 mice in the presence of the ovalbumin peptide (OVA323–339) for 72 h. CD4+ T cells were purified using MACS separation as described in the previous paragraph.

Stimulation of HSV-2–specific CD4+ T Cells by DCs and Other APCs.
To determine the ability of the DCs to stimulate HSV-2–specific T cells, 105 CD4+ T cells from draining lymph nodes of mice infected ivag with 186TKKpn 5 d before were co-cultured with 105 APCs in the presence of the heat-inactivated virus or heat-inactivated nonvirus-infected cell lysate control. Virus-infected (186TKKpn) or uninfected Vero cell control lysate was heat-inactivated at 56°C for 30 min, at which point they were determined noninfectious as assayed by addition to susceptible Vero cells (unpublished data). No difference in proliferation or cytokine secretion was detected between wells that received heat-inactivated cell lysate and those that received media alone (unpublished data). T cells were stimulated for 72 h in vitro by various APCs and the supernatant was tested for cytokines by ELISA as described previously (18). To determine the source of cytokines in the co-culture, T cells or APCs, in some experiments, were inactivated by irradiation at 3,000 rad.

Detection of Viral DNA in Purified DCs.
Total DNA from purified DCs or from infected vaginal epithelium was obtained by resuspending the cell pellet in STE buffer (0.1 M NaCl, 10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and boiling for 10 min. HSV-2 glycoprotein B gene–specific primers HSV2a-1 (forward, 5' CTGGTCAGCTTTCGGTACGA 3') and HSV2a-2 (reverse, 5' CAGGTCGTGCAGCTGGTTGC 3') were used to amplify viral DNA as described previously (20). The presence of genomic DNA was determined by PCR amplification of housekeeping gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) using primers (forward, 5'CTGGAGGCAGGAAGGAGTCC 3'; reverse, 5' GGTCCTCCTACGTTGTCTGG 3') and amplifying for 35 cycles. The lower limit of detection using our PCR protocol was calculated by performing PCR on purified viral DNA as follows. Cell-free 186TKKpn HSV-2 virions propagated in Vero cells were collected from the culture supernatant by centrifugation at 20,000 g at 15°C (rotor SW27; ) for 45 min. The pellet containing cell-free virions was collected, and viral genomic DNA was purified using QIAamp DNA Mini Kit ( ). Eight 10-fold dilutions of DNA were made, and 1 µl of each dilution was used as a template to amplify viral DNA using the HSV2a-1 and HSV2a-2 primers as described above in the previous paragraph. The lower limit of detection by our PCR protocol was 30 viral particles per reaction. Similarly, by isolating total DNA from in vitro–infected Vero cells, our PCR protocol was able to consistently detect as little as one infected cell per reaction.

Real-time PCR Analysis.
TaqMan Real-time PCR amplification and detection were performed using a sequence detector (model ABI 7700; PE Biosystems). HSV-2 TK gene-specific primers (F145, 5' CTGTTCTTTTATTGCCGTCATCG 3' and R263, 5' GTCCATCGCCGAGTACGC 3') and a fluorescence-labeled probe (5' Fam-TTTGAACTAAACTCCCCCCACCTCGC-Tamra 3') were used to detect HSV-2 viral DNA. Reactions were performed in 50-µl volumes containing TaqMan Universal PCR Master Mix (PE Biosystems) with a final concentration of 250 nM of each primer and 200 nM of TaqMan probe, and reactions were amplified for 40 cycles. 104 cell equivalent amount of DNA samples extracted from draining lymph node DCs were run in parallel with duplicated viral DNA standards to determine the quantity of viral DNA molecules. For viral DNA standards, purified HSV-2 viral DNA was serially diluted in the presence of 30 ng genomic DNA of uninfected CV-1 cells. The viral DNA was diluted such that 1 µl of the sample contained 106, 105, 104, 103, 102, 10, and 100 of HSV-2 DNA. As little as two viral DNA copies could be routinely detected in these assays.


     Results

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
LC and DC Distribution in the Vaginal Mucosa during the Estrous Cycle.
To examine the distribution of DCs in the uninfected vaginal epithelium and lamina propria during the estrous cycle, frozen sections of vagina from mice at different stages of the estrous cycle were doubly stained with antibodies to CD11c and MHC class II and analyzed by confocal microscopy () . The epithelial cell thickness was found to be minimal at diestrous (2–3 cells thick;  a) and maximal at estrous (12 cells thick;  b). During the catabolic metestrous-1 stage, the cornified vaginal epithelium begins to shed ( c), and is replaced by numerous neutrophils in the lumen with a few cell layers of remaining epithelium at the metestrous-2 phase ( d). Interestingly, the LCs (MHC class II+ [red]/CD11c+ [green]; yellow) are distributed abundantly during the diestrous and metestrous-2 stages throughout the epithelial layer, but only sparsely near the base of the epithelium during estrous and metestrous-1 phases. Notably, there are no LCs near the lumen of the vagina at these latter stages. Thus, LCs localize near the lumen of the vagina only during the catabolic phases in which the epithelium is maximally thin.


fig-ommitted
 
Figure 1. LC distribution in the vaginal epithelium during the estrous cycle. Frozen sections of vaginal tissues from mice at diestrous (a), estrous (b), metestrous-1 (c), and metestrous-2 (d) phases were stained with antibodies against MHC class II (red) or CD11c (green) and analyzed by confocal microscopy. Confocal images are overlaid with light transmission microscopy images to denote tissue morphology. The white line indicates the luminal edge of the epithelium, whereas the yellow line indicates the basement membrane. The images were captured using objective lenses of 20x (a–c) or 40x (d). L, lumen.

 

 
Submucosal DC Recruitment to the Infected Epithelium.
When mice at different stages of the estrous cycle were infected with HSV-2, only those at diestrous and late metestrous-2 phases or those that received Depo-Provera® treatment became infected (unpublished data), which is consistent with previous reports (36). In an effort to follow the ivag HSV-2 infection and to understand the mechanism of immune induction to HSV-2, mice pretreated with Depo-Provera® were infected ivag with 107 PFU of the TK- strain of HSV-2 (186TKKpn). Frozen sections of the vagina of mice infected for 24 h, 48 h, or 5 d were doubly labeled with antibodies to HSV-2 (red) and CD11c (green) () . In the mock-infected mice, the epithelium and lamina propria contained abundant CD11c+ cells with a similar frequency to those present in uninfected mice (, a, c, e, and g). However, 24 h after ivag infection with HSV-2, numerous CD11c+ DCs were found in the lamina propria just beneath the infected epithelium, creating multiple foci of submucosal DCs ( b). These submucosal DCs were all CD11b+ as demonstrated for the dermal DCs (21). A detailed analysis of the DCs near the infected epithelium showed no evidence of direct infection by HSV-2 ( h). By 48 h, the foci of DCs were replaced by a massive infiltration of DCs throughout the lamina propria and the entire length of the epithelial layer was now infected, which resulted in the shedding of the virally infected, dying epithelia. By day 5, the vaginal tract was devoid of most epithelial cells ( f) and virally infected cells became rare. By days 7–10, the anatomy of the vaginal mucosal returned to normal with the exception of the appearance of clusters of lymphocytes near the lumen (unpublished data). Thus, successful HSV-2 replication occurred exclusively in the epithelial cells in progesterone-dominant mice; CD11c+/CD11b+ submucosal DCs were recruited to the lamina propria just beneath the infected epithelium as early as 24 h a.i.


fig-ommitted Figure 2. DC recruitment to the HSV-2–infected vaginal epithelium. BALB/c mice pretreated with Depo-Provera® were inoculated with ivag TK mutant HSV-2 (b, d, f, and h), or with control cell lysate (a, c, e, and g), and vaginal tissues were collected for staining with antibodies against CD11c (green) and HSV-2 (red) at 24 h (a, b, g, and h), 48 h (c and d), or 5 d (e and f) a.i. The nucleus was visualized by staining with DAPI (blue). Images were captured using a 20x objective lens (a–f) or with 40x lens (g and h). The epithelial layer is indicated by the white arrowheads (luminal edge) and yellow arrowheads (basement membrane). Panels g and h represent higher magnification images of the selected areas in panels a and b, respectively.

 

 
Dendritic Cells Present HSV-2 Peptides in the Draining Lymph Node.
To understand the role of DCs in the immune induction to HSV-2, we collected DCs in the draining lymph nodes at different time points after ivag infection with 186TKKpn. The draining lymph node cells were positively selected on the basis of CD11c expression using magnetic beads. The percentage of DCs expressing co-stimulatory molecules CD80 and CD86 increased within the first few days and returned to normal levels by 7 d a.i. ( a). Next, the ability of the draining lymph node DCs to present in vivo–derived viral antigens was examined by co-culture of CD4+ T cells isolated from day 5 draining lymph nodes of HSV-2–infected mice in the absence of exogenously added antigens. The cytokine secretion induced by DCs from HSV-2–specific CD4+ T cells was detected as early as 2 d a.i. and persisted for up to 10 d a.i. (). Significant levels of IFN were induced by DCs draining the lymph nodes between 2 and 5 d a.i. ( b). The same DCs stimulated much lower levels of IL-10 ( c) and barely detectable levels of IL-4 ( d) from CD4+ T cells. None of these cytokines were detected from CD4+ T cells isolated from mock-infected mice stimulated under these conditions (unpublished data). All cytokines (IFN, IL-4, and IL-10) were found to be secreted from CD4+ T cells, but not DCs, because cytokine levels diminished in the co-culture of irradiated CD4+ T cells with live DCs, but not in cultures of irradiated DCs with live CD4+ T cells (unpublished data).

Although cytokines were not detected from the CD4+ T cells in noninfected mice stimulated with DCs from infected mice, it was possible that the cytokine secretion observed in the DC–T cell co-culture in  (b–d) reflected nonspecific stimulation of in vivo–primed T cells by the activated DCs in the draining lymph nodes. To address these possibilities, we performed two sets of experiments. First, to determine whether the draining lymph node T cells secreted cytokines in a nonantigen-specific manner, CD4+ T cells from mice infected for 4 d with HSV-2 were co-cultured with in vitro–stimulated transiently adherent splenic DCs. In the absence of viral antigen, even though the transiently adherent overnight-stimulated DCs were fully activated, they were not able to induce secretion of cytokines from the draining lymph node CD4+ T cells ( e). Thus, the draining lymph node CD4+ T cells require recognition of viral antigens for activation and secretion of cytokines. Second, to determine whether the DCs in the draining lymph nodes stimulated T cells nonspecifically, CD4+ T cells from DO11.10 mice were preactivated in vitro in the presence of OVA323–339 peptide. These maximally activated clonal T cells were coincubated with draining lymph node DCs from day 3 HSV-2–infected mice in the presence or absence of the OVA peptide. Although activated DO11.10 T cells secreted large amounts of cytokines in the presence of the specific peptide, day 3 a.i. draining lymph node DCs were not able to induce cytokine secretion in the absence of the antigenic peptide ( f). Thus, cytokine secretion in the DC–T cell co-culture requires the presence of specific viral antigens, and the mere activation status of the CD4+ T cells, DCs, or both in combination, does not account for the cytokines observed in the co-culture.

Dendritic Cells Are the Primary APCs in IFN Induction from CD4+ T Cells.
In an effort to examine the relative contribution of different APC populations in T cell priming during ivag HSV-2 infection, we isolated both the CD11c+ and CD11c- fractions of the draining lymph node cells from mice infected ivag 5 d before. This time point was chosen based on the ability of the draining lymph node DCs between days 2 and 5 a.i. to optimally stimulate T cells in vitro as shown in . The CD11c-depleted population was further divided into B220+/CD11c- and I-Ad+/CD11c- groups ( a). The two populations of DCs (MHC class IImed vs. MHC class IIhi cells) were present in the lymph nodes as described previously (22). When HSV-2–specific CD4+ T cells isolated from day 5 draining lymph nodes of HSV-2–infected mice were co-cultured with these APC populations, remarkably, only T cells stimulated with CD11c+ DC population secreted high levels of cytokines, whereas those stimulated with CD11c-depleted lymph node APCs or with B cells had minimal IFN and IL-10 secretion (). The lack of T cell stimulation by CD11c- APCs was not due to their inherent inability to present antigen on MHC class II molecules because all APCs stimulated strong cytokine secretion from HSV-2–specific T cells when exogenous viral antigens were provided in vitro (). Together, during HSV-2 infection, CD11c+ DCs represent the primary APCs in stimulating IFN secretion from viral antigen-specific T cells in the draining lymph nodes.

Dendritic Cells Acquire HSV-2 Antigens in the Absence of Direct Infection.
The draining lymph node DCs could have acquired the viral antigen either by phagocytosis of infected epithelium or by direct HSV-2 infection. To our surprise, no evidence of DC infection was detected by examination of viral protein by immunofluorescence staining () or by detection of viral DNA by PCR () . The lower limit of detection was 30 cell-free viral particles or one infected Vero cell per reaction using our PCR protocol (Materials and Methods). To rule out the possibility of a very low number of HSV-2 viral replication within DCs, a more sensitive method of detection of viral DNA was used. 104 cell equivalents of total DNA from draining lymph node DCs at days 1–3 a.i. were subjected to Real-time PCR. Despite our ability to consistently detect as little as two viral DNA copies per reaction, and that approximately one million viral DNA copies were detected from vaginal epithelial layers from the same mouse, none of the DNA samples isolated from the draining lymph node DCs had demonstrable viral DNA ( b). Moreover, no viral DNA was detected from total lymph node cell suspension ( b), indicating that viral replication is strictly confined to the vaginal epithelial cells and that virus does not travel to the draining lymph nodes.


fig-ommitted
 
Figure 5. Draining lymph node DCs do not contain HSV-2 viral DNA. Total DNA was isolated from DCs from the draining lymph nodes of mice inoculated ivag with HSV-2 or with control cell lysate using magnetic beads. (a) HSV-2 viral DNA was amplified using specific primers by PCR. DNA isolated from 24 h HSV-2–infected vaginal epithelium was used as a positive control for HSV-2–specific gene amplification. The presence of genomic DNA in each sample is depicted by PCR amplification of the housekeeping HPRT gene. To further confirm the lack of viral DNA in the DCs and total draining lymph node cells, either 104 (DCs) or 105 (total lymph node cells) cell equivalents of DNA was subjected to Real-time PCR at days 0, 1, 2, or 3 a.i. (b). In parallel, DNA obtained from the vaginal epithelial layer (sites of viral replication) at the corresponding time points were also examined by Real-time PCR as a positive control for infection in these mice. These reactions were conducted twice with similar results.

 

 
Activation of CD4+ T Cells in the Draining Lymph Nodes and in the Spleen.
To determine the time course of T cell activation and migration in vivo, CD4+ T cells were isolated at various time points after ivag HSV-2 infection from the draining lymph nodes and were incubated with irradiated splenocytes from naive syngeneic mice pulsed with either heat-inactivated virus or control lysate. After a 72-h incubation in vitro, the supernatants were analyzed for secretion of IFN, IL-4, and IL-10 () . Both IFN and IL-10 secretions were detected from T cells within the draining lymph nodes starting at 3 d a.i. and persisted for up to 14 d a.i. Only minor levels of IL-4 were secreted from these cells. Thus, antigen-specific CD4+ T cells became detectable in the draining lymph nodes of ivag-infected mice at 3 d a.i. and continued to be present until 14 d. In the spleen, HSV-2–specific T cell responses were detected with a similar cytokine secretion profile to those in the draining lymph nodes. However, the appearance of HSV-2–specific T cells in the spleen began only after 5 d a.i., which represents a 2-d lag from the draining lymph node response, and disappeared by 14 d a.i. ().


fig-ommitted Figure 6. Cytokine secretion from CD4+ T cells in draining lymph nodes and spleen of ivag HSV-2–infected mice. CD4+ T cells positively selected from draining lymph nodes (a–c) and spleen (d–f) of mice infected ivag with 186TKKpn for various time periods were co-cultured with irradiated syngeneic splenocytes in the presence of heat-inactivated HSV-2 (filled bars) or heat-inactivated control cell lysate (white bars) for 3 d and supernatants were analyzed for IFN (a and d), IL-10 (b and e), or IL-4 (c and f).

 

 
Submucosal DCs Present Viral Peptides to CD4+ T Cells in the Draining Lymph Nodes.
In an effort to delineate the contribution of LCs and submucosal DCs in T cell priming after HSV-2 infection, LC-derived DCs and submucosally derived DCs in the draining lymph nodes were isolated by flow cytometric cell sorting. LC-derived DCs were identified by staining with an antibody to gp40, a murine homologue of the human epithelial cell adhesion molecule (23, 24). The gp40 molecule has been previously demonstrated to be expressed specifically by LCs and not by other DCs (23, 24). The submucosal CD11c+ DCs were identified by the expression of CD11b because CD11b is expressed on all submucosal DCs as shown previously for dermal DCs (21). First, we confirmed that the gp40 expression was only detected in subcutaneous and vagina-draining lymph nodes and was absent in nonskin-draining lymph nodes, such as the mesenteric lymph nodes ( a). Second, phenotypic analysis of the LC-derived gp40+ DCs revealed that they were DEC205hi, CD8lo with moderate to high expression of CD11b ( b), a profile completely consistent with the phenotype of LCs in subcutaneous lymph nodes (25). The FACS® analysis of LCs (gp40+) and submucosal DCs (CD11b+/gp40-) revealed that in the draining lymph nodes, LC population diminishes whereas submucosal DCs increase in percentage after HSV-2 infection ( b). Strikingly, when the antigen-presenting capacity of these DC populations were compared, only the CD11b+ submucosal DCs, but not gp40+ LCs, were found to present viral antigens to CD4+ T cells ( c), despite their equal ability to present exogenously added viral antigens to HSV-2–specific CD4+ T cells ( d). Next, the ability of the other major lymph node DC subset, namely the CD8+ DCs, to present viral antigens to CD4+ T cells was examined. The CD8+ DCs have been shown to play a critical role in cross-presentation of cell-associated antigens (2628). FACS® analysis of CD8+ DCs revealed that they also do not present HSV antigens to CD4+ T cells in the draining lymph nodes (). Together, these data collectively show that submucosal DCs are recruited to the infected epithelium, phagocytose exogenous viral antigens, migrate to the draining lymph nodes, and are uniquely capable of presenting viral antigenic peptides to CD4+ T cells.


fig-ommitted Figure 7. Submucosal DCs, but not Langerhans cells or CD8+ DCs, present viral peptides to CD4+ T cells in the draining lymph nodes. To differentiate the contribution of LCs and submucosal DCs in the presentation of HSV-2 antigens in vivo, CD11c+ cells were stained with gp40 (LC) and CD11b (submucosal DC) after HSV-2 ivag infection at 2 or 4 d a.i. and were analyzed by flow cytometry (a). The DC markers, DEC-205, CD8, and CD11b, on CD11c+ cells were analyzed (b). The LC-derived (gp40+), submucosal DCs (CD11b+), or the CD8+ DCs were FACS®-sorted from draining lymph nodes at 2 or 4 d a.i. and were co-cultured with HSV-2–specific CD4+ T cells in the absence (c) or presence (d) of viral antigens for 72 h. IFNsecreted from T cells were analyzed by ELISA (c and d).

 

 

     Discussion

Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
The mechanism of immune induction to ivag HSV-2 infection is unclear. To better understand the contribution of the vaginal APCs in immune induction to HSV-2, we first examined the distribution of LCs and submucosal DCs in the uninfected vaginal tissues at different stages of the estrous cycle. We demonstrate here that LCs are present during estrous and metestrous-1 only near the base of the epithelium. Because cornified epithelium covers the vaginal mucosa during these stages of the estrous cycle, access by infectious agents to deeper tissues is likely limited. Evolutionarily, the localization of LCs near the mucosal surface may not have been necessary during these particular stages of the menstrual cycle when such a physical protective barrier is provided. On the other hand, during the metestrous-2 and diestrous phases when the shedding of this barrier occurs, the opportunity for sexually transmitted pathogens to invade the host is greatly enhanced due to the lack of protective cornified epithelium and the reduced thickness of the stratum spinosum. Consequently, a higher number of LCs may have been necessary to survey invading microbes at these stages. In the case of HSV-2 infection, mice are found to be susceptible to viral infection only during these catabolic stages (36).

The current paradigm of immune induction to infectious agents at body surfaces covered by squamous epithelium such as the skin and the vagina is that LCs encounter pathogens within the epithelium, take up antigens from the pathogens, and migrate to the draining lymph nodes to prime naive T cells (29). In our current work, the rampant HSV-2 infection of the vaginal epithelium resulted in the complete lysis of the cells in this layer, destroying LCs in this tissue within 48 h a.i. However, rapid recruitment of submucosal CD11c+ DCs just beneath the infected epithelium was observed within 24 h a.i., followed by a subsequent appearance of CD11c+/CD11b+ DCs presenting the viral peptides in the draining lymph nodes by 48 h a.i. To decipher the relative roles of LCs and submucosal DCs in antigen presentation and T cell activation in the draining lymph nodes, LCs and submucosal DCs were isolated by FACS® from draining lymph nodes after HSV-2 infection. Stimulation of HSV-2–specific T cells revealed that only the submucosal DCs, and not LCs, presented viral antigens to CD4+ T cells (). Our observations that submucosal DCs, but not LCs, are the primary cells responsible for T cell priming in the draining lymph nodes after ivag HSV-2 infection are also supported in a paper by Parr et al., which tracked the emigrant cells from vaginal epithelium with a fluorescent dye (12). With this method, no migration of the LCs from the vaginal epithelium to the draining iliac lymph nodes was observed after ivag HSV-2 infection (12). Furthermore, we examined the antigen-presenting capacity of the CD8+ lymph node DCs that have been shown to be responsible for presenting cell-associated antigens to T cells in vivo (2628). Comparison of the ability of the two major subsets of DCs in the draining lymph nodes clearly demonstrates that only the CD11b+ DCs, but not CD8+ DCs, present in vivo–derived viral peptides to CD4+ T cells (). These results indicate that the viral antigens are presented directly by the CD11b+ DCs in the absence of either antigen transfer to the lymph node CD8+ DC or the differentiation of these cells to the CD8+ phenotype. Together, our data demonstrate a previously unrevealed role of the submucosal DCs in antigen presentation to CD4+ T cell after ivag HSV-2 infection, and further provide evidence for the lack of participation by LCs and the CD8+ DCs in this process.

Several studies have examined the consequences of direct infection of DCs by HSV-1 in vitro. Human DCs have been shown to express some of the receptors required to mediate the entry of HSV such as Hve-A and Hve-B and can be infected by HSV-1 in vitro (30, 31). HSV-1 infection was shown to inhibit maturation of immature DCs (30, 31) and their ability to prime naive T cells (31). Our in vivo examination with TK- HSV-2 revealed that the infection was not detected within the emigrant DC populations in the draining lymph nodes, despite the proximity of recruited submucosal DCs to the infected epithelium. In fact, the draining lymph nodes did not contain any viral DNA. Our finding is consistent with the paper by Mueller et al., which demonstrates that despite rapid activation of CD8+ T cells after footpad HSV-1 infection, the draining lymph nodes contained no viral DNA (32). The difference in the infectivity of human blood DCs to HSV-1 in vitro and mouse genital submucosal DCs to HSV-2 in vivo may be explained by a number of factors, including the difference in expression of Hves (unpublished data) and the fact that murine Hve-B does not function as a viral entry mediator for HSV (33). Productive replication of HSV-2 was strictly confined to the epithelial layer, within which LCs reside. Thus, our data suggest that LCs may be inhibited from performing antigen-presenting functions as a result of the lytic destruction of the epithelial layer. This hypothesis is supported by the progressive reduction of the number of LCs in draining lymph nodes after HSV-2 infection ( a). Conversely, we show that HSV-2 infection of the epithelium did not lead to suppression, but instead to activation of the phenotype and function of the neighboring uninfected submucosal DCs. The factors released by the HSV-infected epithelial cells, or the virus itself, are likely responsible for inducing activation of the submucosal DCs.

A clear picture of immune inductive events after ivag HSV-2 infection emerges from our work. Upon entry into vaginal lumen, HSV-2 specifically infects the diestrous vaginal epithelium. This infection event results in the recruitment of submucosal DCs toward the infected epithelium, presumably from both local lamina propria and peripheral sources. After recruitment, the foci of DCs directly beneath the infected epithelium form within 24 h and DCs continue to accumulate for several days. This event in the vaginal mucosa is accompanied by the appearance of DCs that harbor HSV-2 peptide on their cell surface MHC class II capable of stimulating HSV-2–specific T cells in the draining lymph nodes. The DCs that migrate to the draining lymph nodes during the first 2–3 d a.i. express higher levels of costimulatory molecules, and are thus capable of stimulating antigen-specific T cells. Lagging 1 d behind, CD4+ T cells capable of secreting high levels of IFN and moderate levels of IL-10 in an HSV-2–specific manner begin to become detectable in the draining lymph nodes first, and subsequently in the spleen. The HSV-2–specific Th1 cells found in the spleen likely migrated from the priming lymph nodes because we detected no evidence of antigen-presenting DCs in the spleen or in any other nondraining lymph nodes at any time points examined. To our surprise, despite the fact that numerous CD4+ T cells were present in the draining lymph nodes at 14 d a.i., we did not detect cytokine secretion from CD4+ T cells by this time point. Furthermore, HSV-2–specific CD4+ T cells were not found in the spleen at this time. It is possible that regulatory T cells develop in these tissues that prohibit secretion of cytokines from effector Th1 cells. Alternatively, the HSV-2–specific effector memory T cells may have migrated to nonlymphoid tissues as described for lymphocytic choriomeningitis virus (34). In support of the latter possibility, despite our inability to detect effector T cells in the lymphoid tissues after 14 d a.i., these cells are clearly present and are recruited rapidly to the sites of infection and mediate protective immunity during secondary viral challenges (8, 9).

Our data provide the first evidence of the critical role played by the submucosal vaginal DCs in eliciting IFN-mediated CD4+ T cell responses during ivag HSV-2 infection. Because the expression of receptors and adhesion molecules for various sexually transmitted pathogens may differ significantly between the submucosal DCs and LCs of the vaginal mucosa (35), our results suggest the importance of the involvement of the submucosal vaginal DC populations in disease pathogenesis and in immune induction to other microbial agents of sexually transmitted diseases.


     Acknowledgments
 
We wish to thank Drs. Charlie Janeway, Ruslan Medzhitov, and Charles Dela Cruz for critical discussion.

A. Iwasaki was supported by a Burroughs Wellcome Fund Career Award in Biomedical Sciences. D.M. Knipe was supported by the National Institutes of Health grants P01NS35138 and AI42257.

Submitted: July 2, 2002
Revised: November 7, 2002
Accepted: November 7, 2002


     References

日期:2007年5月18日 - 来自[2003年第162卷第2期]栏目

Priming of Human Immunodeficiency Virus Type 1 (HIV-1)Specific CD8+ T Cell Responses by Dendritic Cells Loaded with HIV-1 Proteins

1Graduate School of Public Health and 2School of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania; 3Immunex Corporation, Seattle, Washington; 4University of Oklahoma Health Sciences Center, Oklahoma City

Received 2 August 2002; revised 3 October 2002; electronically published 19 December 2002.

Proteins may serve as ideal CD8+ T cell immunogens for human immunodeficiency virus type 1 (HIV-1) if they can be delivered to and processed through the human leukocyte antigen class I pathway. This study shows that human blood monocytederived dendritic cells loaded with liposome-complexed HIV-1 proteins and matured with CD40 ligand can prime CD8+ T cells to HIV-1 in vitro. Whole HIV-1 protein in liposome may be an effective immunogen for HIV-1 vaccine protocols.

 


      Presented in part: Dendritic Cells at the Host-Pathogen Interface Conference, sponsored by the National Institute of Allergy and Infectious Diseases, Warrenton, Virginia, 7 May 2002.
     Informed consent was obtained from the study subjects, and this study was done in accordance with experimentation guidelines of the US Department of Health and Human Services and the Institutional Review Board of the University of Pittsburgh.
     Potential conflict of interest: E.K.T. is an employee of Immunex Corporation, who supplied the CD40 ligand for this study.
     Financial support: National Institutes of Health (grants R01 AI41870, U01 AI37984, U01 AI35041, R01 CA24553, and T32 AI 07487).

      Present affiliation: Department of Immunology, Section of Immunobiology, Yale University School of Medicine, New Haven, Connecticut.
     Reprints or correspondence: Dr. Charles R. Rinaldo, Jr., A427 Crabtree Hall, Graduate School of Public Health, 130 DeSoto St., University of Pittsburgh, Pittsburgh, PA 15261 ().


     Generation of antigen-specific, primary CD8+ cytotoxic T lymphocyte (CTL) responses represents a challenge to the development of protein-based vaccines for prevention of human immunodeficiency virus type 1 (HIV-1) infection. The conventional mechanism for antigenic processing of extracellular proteins is through an endocytic pathway for presentation by major histocompatibility complex (MHC) class II molecules to CD4+ T cells [1]. One potential strategy to induce vigorous MHC class Irestricted CTL responses with viral proteins involves specific targeting to the cytosol of antigen-presenting cells (APCs), particularly dendritic cells (DCs), with carriers such as liposome for accessing alternative MHC class I antigen-processing pathways (termed "cross-presentation") [2]. We have previously demonstrated that lipofectin, a cationic liposome, provides a means of delivering exogenous proteins in vitro to human DCs for more efficient induction of HIV-1 specific, memory CD8+ CTL responses than protein alone [3]. The present study investigated whether DCs loaded with protein-liposome complexes can prime antiHIV-1 CD8+ T cell responses.

     Materials and methods.     To obtain immature DCs (iDCs), CD14+ monocytes were positive selected from peripheral blood mononuclear cells (PBMC) of healthy donors using anti-CD14 monoclonal antibody (MAb)coated magnetic microbeads (Miltenyi) and cultured in AIM V medium (GIBCO) containing 1000 U/mL of recombinant interleukin (IL)4 and 1000 U/mL recombinant granulocyte-monocyte colony stimulating factor (GM-CSF; Schering-Plough) [4]. The number of viable DCs was determined by typical DC morphology in trypan blue dyestained preparations. The purity of the DCs was 90% on the basis of the expression of HLA-DR molecules and lack of expression of lineage markers by flow cytometry [4]. The maturation state of the DCs was determined by expression of CD80, CD83, and CD86.

     The toxicity of lipofectin, composed of DOTMA (N-[1-{2,3-dioleyloxy} propyl]N, N, N-trimethylammonium chloride)/DOPE (dioleoyl-phosphotidylethanolamine) (GIBCO), was determined by loading iDCs with graded doses at 37°C for 0, 2, 4, and 8 h. The viability of the DCs by trypan blue dye exclusion was >90% when lipofectin was added at 15 g/mL for up to 8 h, and decreased at higher concentrations of liposome. Therefore, 15 g/mL lipofectin was used in this study.

     The vaccinia virus (VV) constructs contained gag p24 or p55 for BH10 and HxB2 strains of HIV-1 (VV-Gag p24 and VV-Gag p55; Therion Biologics). VV-Env was vPE11 containing the env coding region of HIV-1 BH10 minus the signal sequence (B. Moss, National Institutes of Health [NIH], Bethesda, MD). The NYCBH strain of VV (VV-Vac; Therion) was used as control virus. Synthetic peptides representing previously identified HLA class Irestricted Gag and Env epitopes were prepared by the University of Pittsburgh Peptide Synthesis Facility.

     For preparation of APCs, 15 g/mL lipofectin was mixed with 20 g/mL HIV-1 p24 Gag or gp160 Env (IIIB; Protein Sciences) or p55 Gag (SF2; Chiron; AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH) and incubated for 10 min at room temperature [3]. The lipofectin-protein mixture was added to 1 × 106 iDCs on day 7. The cells were incubated for 4 h at 37°C in 5% CO2 and treated with human CD40L trimer (12.5 g/mL; Immunex) for 2 days to induce phenotypic and functional maturation (defined as mature DCs [mDCs]). Control samples were APCs only and APCs loaded with either liposome or HIV-1 protein. In some experiments, the iDCs were obtained from plastic adherent PBMC and matured with monocyte-conditioned medium (MCM) [4].

     After incubation, the cells were washed and left untreated, or treated with psoralen (10 g/mL; Calbiochem) and UV light (PUV) [5]. Cryopreserved PBMC were primed with antigen-loaded, autologous mDCs for 1 week and then stimulated with antigen-loaded, autologous PBMC as APCs for weeks 25 at an effector cell-to-APC ratio of 10 : 1 in RPMI 1640 medium containing antibiotics, 15% heat inactivated fetal calf serum, and recombinant human interleukin (IL)2 (100 U/mL; Chiron). The effector cell-APC mixtures were seeded into round-bottom microtiter wells, with fresh medium and IL-2 added every 34 days.

     Antigen stimulated cells were harvested and washed after 4 or 5 weeks when there were adequate T cells for CTL assay. In some experiments, CD8+ and CD4+ T cells were enriched to 98% and 90% purity, respectively, from cultured cells by negative selection using immunomagnetic beads (Dynal) [5]. The targets were autologous B-LCLs infected with the VV vectors or loaded with synthetic HIV-1 peptides (100 g/mL) and labeled with 51Cr [4]. PBMC were typed for HLA class I by high resolution, reference strand mediated conformation analysis. To block CTL reactivity, target cells were incubated with anti-HLA class I (5 g/mL; Accurate Chemical) or anti-HLA class II MAbs (5 g/mL; Beckman Coulter) for 45 min at 37°C before adding to the effector cells. The CTL lysis assay was done in triplicate at effector/target (E/T) cell ratios of 40, 20, and 10. Specific lysis was calculated as 100 × [(experimental copies per minute {cpm} - spontaneous cpm)/(maximum cpm - spontaneous cpm)]. The percentage of antigen-specific lysis was calculated as (percentage lysis of VV-Gag or VV-Env infected or HIV-1 peptide loaded targets) - (percentage lysis of VV-vac infected or mock treated targets). The mean (±SE) lysis of the uninfected and VV-vac infected targets by the antigen-stimulated effectors at the various E/T ratios was 8% ± 3% (n = 18) and 7% ± 1% (n = 27), respectively. The coefficient of variation for cpm among replicate CTL values was 7% ± 1%. A positive CTL response was defined as 10% antigen-specific lysis.

     Results.     Expression of costimulatory molecules CD80 and CD86, HLA-DR, and the Ig superfamily, DC surface maturation marker, CD83, was up-regulated on CD40L-treated DCs as compared to non-CD40L-treated DCs, indicating that the CD40L treatment induced DC maturation [4, 5]. Loading of iDCs or mDCs with either liposome, p24 Gag, or their combination did not alter expression of these surface molecules (data not shown).

     We next established the parameters for in vitro priming by confirming the work of Zarling et al. [6], which used 1 week of priming of PBMC with HIV-1 Gag peptide-loaded, MCM-matured DCs, followed by weekly, sequential stimulations with Gag peptide-loaded PBMC to induce anti-Gag CD8+ CTL responses (data not shown). Priming with peptide-loaded iDCs did not induce CTL reactivity. In subsequent experiments, we used CD40L-matured DCs, because this treatment resulted in a more consistent maturation of the DCs [4].

     Stimulation of PBMC from an HIV-1negative subject with autologous mDCs that had been loaded with HIV-1 Gag p55 protein-liposome induced greater levels of antiHIV-1 CD8+ T cell responses than mDCs loaded with HIV-1 Gag p55 protein alone (). Similar priming was elicited by PUV-treated mDCs that had been loaded with Gag p55-liposome (). The lytic reactivity was HLA class I restricted as shown by blocking of lysis by antiHLA class I but not antiHLA class II MAbs (). To date, we have observed that CTLs specific for Gag or Env can be consistently primed by autologous mDCs loaded with these HIV-1 recombinant protein-liposome complexes in multiple PBMC samples obtained from 7 different subjects (data not shown).

fig.ommitted

Figure 1.        Priming of human immunodeficiency virus type 1 (HIV-1)specific CD8+ cytotoxic T lymphocyte (CTL) responses by different antigen-presenting cells (APCs). Priming of HIV-1specific CTL in peripheral blood mononuclear cells (PBMC) from a HLA A*0201, B*27 subject by 1 week of stimulation with autologous mature dendritic cells (mDCs; either untreated or psoralen UV [PUV] treated), monocytes, or PBMC loaded with Gag p55-liposome, followed by 4 sequential weekly stimulations with autologous PBMC loaded with the same antigen (A). Results are the mean of triplicate values of antigen-specific lysis. The results show positive CTL responses (10% specific lysis) to autologous B cell lines loaded with known CD8+ T cell epitopes for HLA A*0201 p24151159 (TLNAWVKVV), and B*27 p24263272 (KRWIILGLNK) and p171927 (IRLRPGGKK), but not for HLA A*0201 p177785 (SLYNTVATL). The CTL activity was blocked by anti-HLA class I monoclonal antibody (MAb) but not anti-HLA class II MAb (B). E/T, effector/target cell ratio.

     The HLA class I specificity and breadth of this primary CD8+ T cell response was further demonstrated by killing of autologous targets expressing 3 of 4 HLA A*0201 and HLA B*27 HIV-1 peptides (). We confirmed the specificity of CD8+ T cells primed by mDC loaded with either Gag p24 or p55 and liposome for p24151-159 (TLNAWVKVV) in 5 of 6 HLA A*0201 subjects. In further experiments, priming of CTLs from another HLA A*0201 person with mDCs loaded with gp160-liposome induced CTLs specific for HLA A*0201 epitopes gp120311320 (RGPGRAFVTI) and gp41747755 (RLVNGSLAL), but not gp120192199 (KLTSCNTSN) or gp41818-827 (SLLNATDIAV) (data not shown). Similarly, CTLs from an HLA A*03 B*07 person that were primed by mDCs loaded with Gag p24- and Env gp160-liposome complexes were specific for HLA B*07 p24179187 (ATPQDLNTM) and HLA A*03 gp41775785 (RLRDLLLIVTR) epitopes, but not for the HLA B*07 p24148156 (SPRTNAWV) epitope (data not shown).

     We showed that Gag p55-liposome loaded mDCs more efficiently primed HIV-1specific CD8+ CTLs than did monocytes or PBMC for recognition of targets expressing 4 different Gag epitopes (). Furthermore, mDCs loaded with Gag p55-liposome were superior to iDCs for priming of CTL specific for targets expressing naturally processed Gag proteins (i.e., VV-p24 and VV-p55), as well as targets loaded with a known HLA A*0201 p24 epitope (p24151-159) ().

fig.ommitted

Figure 2.        Priming of human immunodeficiency virus (HIV)-1specific cytotoxic T lymphocyte (CTL) responses by immature dendritic cells (iDCs) and mature (m) DCs loaded with HIV-1 protein-liposome (lipo) complexes. Peripheral blood mononuclear cells (PBMC) from an HLA A*0201 subject were primed for HIV-1specific CTL by 1 week of stimulation with autologous iDCs and mDCs loaded with Gag p24-lipo complexes, followed by 4 sequential weekly stimulations with autologous PBMC loaded with the same antigen. Targets were autologous B cell ines infected with vaccinia virus expressing Gag p55 or p24, or loaded with an HIV-1 peptide (p24151159 [TLNAWVKVV]) representing a known CTL epitope for HLA A*0201. Results are the mean of triplicate values of antigen-specific lysis. E/T, effector/target cell ratio.

     Discussion.     We were consistently able to prime antiHIV-1 CD8+ T cell responses with mDCs loaded with HIV-1 protein-liposome complexes but not with mDCs loaded with HIV-1 proteins alone. In vitro priming of CD8+ T cells to HIV-1 was first demonstrated by Engleman et al. [7, 8] who showed that multiple, sequential stimulations of naive CD8+ T cells with autologous or allogeneic, HLA class Imatched DCs freshly isolated from blood samples and loaded with HIV-1 Gag and Env peptides, could activate HIV-1specific CTL. More recently, monocyte-derived iDCs transduced with an env- and nef-deleted HIV-1 vector pseudotyped by VSV G protein [9], HIV gag-encoded mRNA-transfected DCs [10], or iDCs that were matured with MCM or CD40L and loaded with HIV-1 peptides representing HLA class I epitopes [6, 11], have been used to prime antiHIV-1 CTL in vitro. There is only one report of in vitro priming of CD8+ T cells with whole HIV-1 protein, where Nef-specific CD8+ T cells were primed by repetitive stimulation of PBMC with -irradiated iDCs loaded with HIV-1 Nef protein [12]. In this case, optimal T cell priming required addition of interferon (IFN).

     We found that priming of antiHIV-1 CD8+ T cell responses in vitro required liposome as a delivery vehicle. We believe that this was due, in part, to the unique fusogenic property of the DOPE portion of lipofectin that enhances access of exogenous protein from the endosomes/lysosomes into the cytosol of DCs by destabilizing the endosomes and allowing the release of HIV-1 protein into the cytosol [13]. Moreover, a single stimulation of PBMC for one week with HIV-1 protein-liposome loaded mDCs, followed by multiple, weekly stimulations with protein-liposome loaded PBMC, was sufficient to induce a primary, antiHIV-1 CD8+ T cell response. Initial stimulation with antigen-loaded mDCs was essential for priming, as iDCs, monocytes or PBMC loaded with liposome-complexed HIV-1 protein were poor primers of HIV-1 specific T cells. The mDCs expressed enhanced levels of costimulatory and HLA class II molecules, and these were not altered by addition of liposome-protein complexes. Maturation of DCs with CD40L increases surface expression of HLA and costimulatory molecules and release of cytokines including IL-12 p70 (when combined with IFN- stimulation) and IL-15 from mDCs that enhance antigen-specific CD8+ T cell responses [14]. Such costimulatory CD40/CD40L interactions lower the threshold of antigen required to activate primary T cell responses, and may augment survival of antigen-activated T cells.

     Our data, that PUV-treated mDCs could prime antiHIV-1 CD8+ T cell responses, are concordant with our previous findings among HIV-1infected persons [4]. The PUV-treated DCs are likely undergoing apoptosis, which suggest that viable DCs are not essential for triggering of T cell priming. This may relate to the high levels of costimulatory molecule expression that is retained on PUV-treated DCs (X.-L.H., Z.F., and C.R.R., unpublished data).

     Priming of CD8+ T cells with mDCs loaded with HIV-1 proteins and liposome elicited CTL reactivity against multiple HIV-1 HLA class I epitopes. The levels of lysis were within the range expected for CTL primed by a multi-epitope protein immunogen, using single epitope, individual peptides as targets. Lack of recognition of some HIV-1 peptides by the HIV-1 protein-primed T cells could reflect immunodominance among the peptides for their HLA class I alleles, differences in proteasomal cleavage and heterogeneity of peptide binding due to polymorphism of HLA class I alleles [2].

     We reported elsewhere activation of HIV-1 specific, CD8+ T cells from HIV-1infected persons in vitro by cross-presentation of liposome-complexed HIV-1 proteins by DCs [3]. These studies suggest that complexing of HIV-1 protein with liposome promotes processing of the protein through an alternative, cytosolic pathway for cross-presentation of peptides by HLA class I molecules to both naive and memory CD8+ T cells. Our studies, together with a recent report showing in vitro priming of Gag-specific CD4+ T cells by mDCs loaded with uncomplexed HIV-1 p24 protein [15], suggest that a protein-based antigen approach could be used to prime or boost both antiHIV-1 CD8+ and CD4+ T cell activity in prophylactic and therapeutic vaccine protocols.

Acknowledgments

     We thank K. Picha (Immunex; Seattle, WA) for assistance in providing the CD40L, S. Narula (Schering-Plough; Kenilworth, NJ) for providing hIL-4 and hGM-CSF, and J. Malenka for administrative assistance.

References

 

1. 

Watts C, Amigorena S. Antigen traffic pathways in dendritic cells. Traffic 2000; 1:3127. 

2. 

Yewdell JW, Norbury CC, Bennink JR. Mechanisms of exogenous antigen presentation by MHC class I molecules in vitro and in vivo: implications for generating CD8+ T cell responses to infectious agents, tumors, transplants, and vaccines. Adv Immunol 1999; 73:177.

3. 

Zheng L, Huang XL, Fan Z, Borowski L, Wilson CC, Rinaldo CR Jr. Delivery of liposome-encapsulated HIV type 1 proteins to human dendritic cells for stimulation of HIV type 1specific memory cytotoxic T lymphocyte responses. AIDS Res Hum Retroviruses 1999; 15:101120.

4. 

Fan Z, Huang XL, Borowski L, Mellors JW, Rinaldo CR Jr. Restoration of antihuman immunodeficiency virus type 1 (HIV-1) responses in CD8+ T cells from late-stage patients on prolonged antiretroviral therapy by stimulation in vitro with HIV-1 protein-loaded dendritic cells. J Virol 2001; 75:44139. 

5. 

Zhao XQ, Huang XL, Gupta P, et al. Induction of antihuman immunodeficiency virus type 1 (HIV-1) CD8+ and CD4+ T-cell reactivity by dendritic cells loaded with HIV-1 X4infected apoptotic cells. J Virol 2002; 76:300714.

6. 

Zarling AL, Johnson JG, Hoffman RW, Lee DR. Induction of primary human CD8+ T lymphocyte responses in vitro using dendritic cells. J Immunol 1999; 162:5197204. 

7. 

Mehta-Damani A, Markowicz S, Engleman EG. Generation of antigen-specific CD8+ CTLs from naive precursors. J Immunol 1994; 153:9961003.

8. 

Dupuis M, Peshwa MV, Benike C, et al. Allogeneic dendritic cell induction of HIV-specific cytotoxic T lymphocyte responses from T cells of HIV type 1infected and uninfected individuals. AIDS Res Hum Retroviruses 1997; 13:339. 

9. 

Gruber A, Kan-Mitchell J, Kuhen KL, Mukai T, Wong-Staal F. Dendritic cells transduced by multiply deleted HIV-1 vectors exhibit normal phenotypes and functions and elicit an HIV-specific cytotoxic T-lymphocyte response in vitro. Blood 2000; 96:132733. 

10. 

Weissman D, Ni H, Scales D, et al. HIV Gag mRNA transfection of dendritic cells (DC) delivers encoded antigen to MHC Class I and II molecules, causes DC maturation, and induces a potent human in vitro primary immune response. J Immunol 2000; 165:47107. 

11. 

von Bergwelt-Baildon MS, Vonderheide RH, Maecker B, et al. Human primary and memory cytotoxic T lymphocyte responses are efficiently induced by means of CD40-activated B cells as antigen-presenting cells: potential for clinical application. Blood 2002; 99:331925.

12. 

Wilson CC, Olson WC, Tuting T, Rinaldo CR, Lotze MT, Storkus WJ. HIV-1specific CTL responses primed in vitro by blood-derived dendritic cells and Th1-biasing cytokines. J Immunol 1999; 162:30708.

13. 

Chesnoy S, Huang L. Structure and function of lipid-DNA complexes for gene delivery. Annu Rev Biophys Biomol Struct 2000; 29:2747.

14. 

van Kooten C, Banchereau J. CD40-CD40 ligand. J Leuko Biol 2000; 67:217.

15. 

Schlienger K, Craighead N, Lee KP, Levine BL, June CH. Efficient priming of protein antigen-specific human CD4+ T cells by monocyte-derived dendritic cells. Blood 2000; 96:34908.

日期:2007年5月15日 - 来自[2003年第187卷第2期]栏目

Potential Roles of Follicular Dendritic CellAssociated Osteopontin in Lymphoid Follicle Pathology and Repair and in B Cell Regulation in HIV-1 and SIV Infecti

    Departments of Microbiology, Medicine, Biostatistics
    Computer Science and Engineering, University of Minnesota, Minneapolis, AIDS Vaccine Program, SAIC Frederick, Inc., National Cancer Institute, Frederick, Maryland

    Osteopontin is a multifunctional protein with known roles in bone remodeling, wound healing, and normal and pathological immune responses. We showed in microarray studies that osteopontin gene expression is increased in human immunodeficiency virus type 1 (HIV-1)infected lymphatic tissues after treatment, and we undertook mapping experiments to study osteopontin's possible functions in this context. We discovered species-specific colocalization of osteopontin with the follicular dendritic cell (FDC) network in lymphatic tissues in HIV-1 and simian immunodeficiency virus infections, and we found that changes in FDC-associated osteopontin covary with changes in lymphoid follicles during acute and late stages of infection and in response to treatment. We propose that this localization normally facilitates antibody production and plays a role in B cell abnormalities in infection and in the reconstitution of lymphoid follicles with treatment and that mapping genes identified in microarray studies is a useful experimental approach to gaining a better understanding of function in the context of a particular tissue and disease.

    Osteopontin is a secreted, phosphorylated, acidic glycoprotein that was first identified in studies of bone repair but was subsequently shown to have multiple functions in the repair of other tissues, immune responses, and inflammation [1, 2]. In mineralized tissues, osteopontin binds to the extracellular matrix through interactions between its asparagine-glycine-aspartate sequence and integrins, and it regulates calcium deposition during the stress-induced remodeling of bone. In other tissues, osteopontin promotes wound healing and inhibits ectopic calcification [35]. Osteopontin also functions in the induction of cellular and humoral immune responses [68] and participates in both physiological inflammation during wound healing and immune responses and pathological inflammatory conditions that include arthritides [9, 10], multiple sclerosis [11], and autoimmune diseases [8, 12, 13].

    We recently found that osteopontin gene expression increased in HIV-1infected lymphatic tissues after the institution of highly active antiretroviral therapy (HAART) [14]. We provisionally interpreted this result as possible evidence of the wound-healing functions of osteopontin (described above) in a previously unexamined tissue, but we sought further insight into osteopontin's functions in the reparative response to HAART in lymphatic tissues by mapping the localization of osteopontin. During the course of these studies, we discovered a previously unrecognized association of osteopontin with the follicular dendritic-cell (FDC) network of humans and primates but not that of mice, and we propose that this species-specific association reflects the evolution of osteopontin to facilitate antibody production. In support of this hypothesis, we document (1) changes in FDC-associated osteopontin that parallel the well-known hypergammaglobulinemia and B cell abnormalities observed during the early stages of HIV-1 and simian immunodeficiency virus (SIV) infections, (2) decreases in FDC-associated osteopontin that parallel the destruction of lymphoid follicles during late stages of infection, and (3) during HAART, a coordinate normalization of follicular architecture and FDC-associated osteopontin.

    MATERIAL AND METHODS

    Human lymph-node biopsies.

    After we obtained signed, informed consent, inguinal lymph-node biopsies were performed, by use of standard surgical techniques, on individuals under local anesthesia who were participating in University of Minnesota institutional review boardapproved protocols [15]. A portion of the tissue was placed in 4% paraformaldehyde for 34 h and was then transferred to 70% ethanol and embedded in paraffin for in situ hybridization, immunohistochemical staining, and histological examination.

    Lymph-node biopsies from SIV-infected rhesus macaques.

    Axillary lymph-node biopsies were performed on adult female SIV- and simian retrovirusnegative rhesus macaques under anesthesia before and 1 and 4 weeks after intravenous (iv) inoculation with 2 × 104 ID50 of SIVmac239 (provided by R. Desrosiers, New England National Primate Research Center, Southborough, MA). All animal housing, care, and research were performed in accordance with the Guide for the Care and Use of Laboratory Animals [16] and with protocols approved by the Institutional Animal Care and Use Committee of the National Cancer Institute.

    Immunohistochemical staining.

    For immunohistochemical staining, after blocking to reduce nonspecific binding, sections were reacted sequentially with primary antibody, biotinylated secondary antibody, and ABC reagent, and then were stained with diaminobenzidine and counterstained with hematoxylin-eosin. For osteopontin staining, we used monoclonal antibodies to human osteopontin peptides at the C terminus 3 aa from the thrombin cleavage site (Immuno-Biological Laboratories), goat polyclonal antibodies to full-length recombinant mouse osteopontin (AF808; R&D Systems) and proteolytically derived N- and C-terminal fragments (provided by L. Fisher, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD) [17, 18], rabbit polyclonal antibodies to full-length and N- and C-terminal fragments of recombinant mouse osteopontin (provided by L. Liaw, Maine Medical Center Research Institute, Scarborough, ME), and rabbit polyclonal antibodies that recognize full-length and C-terminal fragments of osteopontin and cross-react with human, pig, and dog osteopontin (abcam 8448; Novus Biologicals).

    In situ hybridization.

    Tissue sections of 8 m were cut and adhered to slides, deparaffinized, and subsequently pretreated for the detection of HIV RNA by in situ hybridization, as described elsewhere [19]. In brief, sections were pretreated with HCl, digitonin, and proteinase K, to enhance the diffusion of probes, and then acetylated, to reduce the nonspecific binding of probes. After the hybridization of a collection of 35S-labeled HIV-1specific riboprobes, sections were washed, treated with ribonuclease, dehydrated, coated with NTB2 (Kodak), and developed and stained after radioautographic exposure. For osteopontin, cDNA from the American Type Culture Collection (ATCC number 61052) was subcloned into the pBluescript II SK(-) plasmid, and an 35S-labeled riboprobe was prepared by incorporation of the label with T7 RNA polymerase.

    Statistical analysis.

    A random-effects model was used to determine the statistical significance of changes in the percentage of FDC-associated osteopontin/lymphatic tissue area attributable to HAART. This analysis was necessary for combining information from 2 small, slightly different studies. The model assumed that the changes in each individual were normally distributed, given some study-specific mean effect, and that these study-specific mean effects were drawn from another normal distribution. The mean of the latter distribution was the estimate of the effect due to HAART. A Bayesian approach was used, and computation was done by first integrating the variance parameters out of the posterior distribution, then directly sampling the other 3 parameters from a histogram approximation of their posterior distribution. Calculations were conducted by use of S-plus software (version 3.4; MathSoft).

    RESULTS

    FDC-associated osteopontin in HIV-1infected and uninfected lymphatic tissues as revealed by mapping studies.

    With the rationale that knowing where osteopontin was expressed in lymphatic tissues would provide additional clues to its function, we determined sites of osteopontin expression by immunohistochemical staining. We had expected from the results of other studies [1, 20] that we would detect osteopontin in cells, but we had not seen a report of an association of osteopontin with lymphoid follicles. We were thus surprised to find that (1) before treatment, during the late stage of HIV-1 infection, osteopontin colocalized with the FDC network in small residual secondary follicles; and (2) 2 months after the initiation of HAART, there was increased osteopontin staining in a pattern characteristic of the FDC network in the large follicles that had reformed by that time (figure 1A and 1B). We confirmed the colocalization of osteopontin protein with the FDC network by staining for the FDC marker CD35 and by revealing, through in situ hybridization, the virions bound to the FDC network [19] before treatment (figure 1C and 1D). We then investigated and documented osteopontin colocalization with the FDC network in follicles in other HIV-1infected and uninfected individuals (figure 1E).

    Binding but not production of osteopontin by FDCs.

    Although the FDC network clearly binds osteopontin, we did not detect osteopontin mRNA in FDCs by in situ hybridization, although we did detect osteopontin mRNA (figure 2A) in cells in the paracortical T cell zone identified by double-label staining as T cells and macrophages (figure 2B and 2C). We conclude that these cells are the local source of osteopontin that binds to the FDC network.

    Increase in FDC-associated osteopontin during HAART.

    We found that the size of the follicles and FDC-associated osteopontin gene expression (figure 1A and 1B) increased in parallel, which suggests that follicle formation and osteopontin synthesis and binding are concurrently regulated. Because the FDC network is slowly reconstituted during HAART [21], we would therefore expect corresponding increases in FDC-associated osteopontin gene expression. We quantified FDC-associated osteopontin as a percentage of the area of lymphatic tissues stained by antibody in a total of 12 individuals in 2 separate studies over the course of 1.5 years of HAART; indeed, we found, in a meta-analysis of the separate studies, statistically significant increases (P = .02) in FDC-associated osteopontin gene expression that closely matched the increases previously documented in the FDC network (data not shown) [21].

    Increase in FDC-associated osteopontin gene expression during acute SIV infection.

    The increases in both osteopontin gene expression and the number and size of lymphoid follicles imply that FDC-bound osteopontin gene expression should also increase with the well-documented and particularly dramatic increases in the numbers and sizes of the follicles during the early stage of HIV-1 infection [22]. For obvious practical and ethical reasons, lymph-node biopsies cannot be obtained during the relevant time frame (before and shortly after HIV-1 infection) for testing this hypothesis. However, we were able to study lymph nodes obtained before and during acute SIV infection of rhesus macaques, a nonhuman primate model in which the changes in lymphatic tissues correspond closely to those in HIV-1 infection [23, 24]. Osteopontin colocalized to the rhesus macaque FDC network (figure 3A) and to cells in the paracortex (figure 3A, inset); in accordance with the hypothesis, FDC-bound osteopontin gene expression increased substantially and proportionately with the increased numbers and sizes of the follicles accompanying immune activation in response to infection at 1 and 4 weeks after iv infection with SIV (figure 3).

    No detection of FDC-associated osteopontin gene expression in the mouse.

    In addition to the follicular hyperplasia described above, polyclonal B cell activation and hypergammaglobulinemia are also characteristic of early HIV-1 infection [2427]. Because the increased FDC-associated osteopontin gene expression observed in acute SIV infection pointed to a potential role of osteopontin in these B cell abnormalities that we could not directly test in fixed tissues, we designed experiments with model antigens to examine the relationship between osteopontin gene expression and antibody production in mice. Because we had not seen descriptions of osteopontin colocalizing with the FDC network in mice, and because of the many examples of differences in mouse and human immune systems [28], we first undertook some preliminary experiments to determine whether osteopontin was, in fact, associated with murine FDCs. Although the osteopontin antibodies readily detected osteopontin-positive cells in the paracortex and follicles (figure 4) of mouse (B6 and other strains) lymph nodes, there was no detectable FDC-associated osteopontin in polyclonal and monoclonal antibodies to full-length recombinant mouse osteopontin and proteolytically derived N- and C-terminal fragments. Thus, osteopontin's association with the FDC network is species specific.

    DISCUSSION

    In the present studies, we found that (1) there is a species-specific association of osteopontin with the FDC network and (2) changes in the levels of FDC-associated osteopontin gene expression are correlated with pathological abnormalities in lymphoid follicles in HIV-1 and SIV infections and the reparative response to HAART. We now discuss what these findings might imply about FDC-associated osteopontin's roles, both normally in antibody production and in immunodeficiency virus infections.

    The association of osteopontin with the FDC network locates a powerful antibody-stimulating cytokine in the lymphoid follicle structure, which is organized to bring together antigen bound to the FDC network, B cells, and germinal-center CD4+ cells to stimulate B cell proliferation and differentiation for the production of high-affinity antibodies. The FDC-associated osteopontin could be contributing to antibody production at this site by facilitating FDCCD4+ cell germinal-center interactions that augment Th1 cytokine and CD40L expression. Because osteopontin is known to augment CD40L expression in T cells [32], FDC-associated osteopontin is ideally sited anatomically to increase the expression of CD40L on CD4+ cells in close proximity to B cells, thereby inducing B cell proliferation and antibody production.

    Osteopontin in mice, similarly, has long been known to stimulate antibody production and B cell proliferation through CD40-CD40L and other interactions with CD4+ cells. T cells and macrophages also produce osteopontin in mice, just as we have shown in humans and nonhuman primates. However, osteopontin was not detectably bound by FDCs in mice, in contrast to what was seen in primate species. Although the murine and human osteopontin sequences are closely related [3335], we conclude from the present studies that the additional sequences that osteopontin has acquired through evolution enable it to bind to FDCs for the facilitation of antibody production.

    In all 3 species, elevated levels of osteopontin were implicated in B cell abnormalities. In mice, high levels of osteopontin were associated with polyclonal B cell activation, autoimmune disease, and murine AIDS, respectively, in MRL/lpr mice, osteopontin-transgenic mice, and mice infected with the retrovirus LP-BM5 [8, 12, 13, 20]. In human and nonhuman primate lymphatic tissues, changes in the levels of FDC-associated osteopontin that could be contributing to the B cell abnormalities observed in HIV-1 and SIV infections and to the pathological changes in lymphoid follicles in these infections that cover a spectrum from follicular hyperplasia, to involution, to the development of lymphomas [22, 29]. During the early stages of infection, the deposition of viral immune complexes in the FDC network is associated with increases in the number and size of the follicles and with the concomitant generalized polyclonal activation of B cells that results in hypergammaglobulinemia [24, 26, 27, 30]. Recent evidence has suggested that hyperactivated naive B cells are responsible for increased immunoglobulin production [31] and that the abnormal differentiation of naive B cells is driven by CD40-CD40L interactions that would be enhanced by FDC-associated osteopontin gene expression.

    By the later stages of infection, HIV-1 and SIV have destroyed lymphoid follicles, with accompanying defects in the humoral immune response to recall antigens and vaccination that reflect structural damage and reductions in the number of memory B cells [31]. We had shown previously that this destructive process is reversible by HAART. During HAART, follicles reformed over a period from a few months to 1.5 years of treatment; by the latter time point, levels were similar in proportion to numbers of follicles in HIV-1uninfected individuals [36]. Here, we have provided encouraging evidence that the capacity to regenerate FDC-associated osteopontin is retained as another component of the immune reconstitution that takes place during HAART.

    Finally, the present studies illustrate how mapping the cellular and anatomic location of genes discovered in microarray studies can help define function in a particular tissue and disease. In particular, in the immunodeficiency virus infection of lymphatic tissues, there would have been no a priori reason or literature on osteopontin to suspect binding to FDCs and, therefore, a potentially new role in normal and abnormal B cell states. Thus, mapping studies can complement gene profiling by pointing the way forward from hypothesis generation to hypothesis testing.

    Acknowledgments

    References

    1.  Denhardt DT, Noda M, O'Regan AW, Pavlin D, Berman JS. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J Clin Invest 2001; 107:105561. First citation in article

    2.  Gravallese EM. Osteopontin: a bridge between bone and the immune system. J Clin Invest 2003; 112:1479. First citation in article

    3.  Liaw L, Birk DE, Ballas CB, Whitsitt JS, Davidson JM, Hogan BLM. Altered wound healing in mice lacking a functional osteopontin gene (spp1). J Clin Invest 1998; 101:146878. First citation in article

    4.  Speer MY, McKee MD, Guldberg RE, et al. Inactivation of the osteopontin gene enhances vascular calcification of matrix Gla protein-deficient mice: evidence for osteopontin as an inducible inhibitor of vascular calcification in vivo. J Exp Med 2002; 196:104755. First citation in article

    5.  Steitz SA, Speer MY, McKee MD, et al. Osteopontin inhibits mineral deposition and promotes regression of ectopic calcification. Am J Pathol 2002; 161:203546. First citation in article

    6.  Patarca R, Freeman GJ, Singh RP, et al. Structural and functional studies of the early T lymphocyte activation 1 (Eta-1) gene. J Exp Med 1989; 170:14561. First citation in article

    7.  Ashkar S, Weber GF, Panoutsakopoulou V, et al. Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity. Science 2000; 287:8604. First citation in article

    8.  Lampe MA, Patarca R, Iregui MV, Cantor H. Polyclonal B cell activation by the Eta-1 cytokine and the development of systemic autoimmune disease. J Immunol 1991; 147:29026. First citation in article

    9.  Yamamoto N, Sakai F, Kon S, et al. Essential role of the cryptic epitope SLAYGLR within osteopontin in a murine model of rheumatoid arthritis. J Clin Invest 2003; 112:1818. First citation in article

    10.  Yumoto K, Ishijima M, Rittling SR, et al. Osteopontin deficiency protects joints against destruction in anti-type II collagen antibody-induced arthritis in mice. Proc Natl Acad Sci USA 2002; 99:455661. First citation in article

    11.  Chabas D, Baranzini SE, Mitchell D, et al. The influence of the proinflammatory cytokine, osteopontin, on autoimmune demyelinating disease. Science 2001; 294:17315. First citation in article

    12.  Iizuka J, Katagiri Y, Tada N, et al. Introduction of an osteopontin gene confers the increase in B1 cell population and the production of anti-DNA autoantibodies. Lab Invest 1998; 78:152333. First citation in article

    13.  Patarca R, Wei F-Y, Singh P, Morasso MI, Cantor H. Dysregulated expression of the T cell cytokine Eta-1 in CD4 and CD8 lymphocytes during the development of murine autoimmune disease. J Exp Med 1990; 172:117783. First citation in article

    14.  Li Q, Schacker T, Carlis J, Beilman G, Nguyen P, Haase AT. Functional genomic analysis of the response of HIV-1infected lymphatic tissue to antiretroviral therapy. J Infect Dis 2004; 189:57282. First citation in article

    15.  Schacker TW, Nguyen PL, Beilman GJ, et al. Collagen deposition in HIV-1 infected lymphatic tissues and T cell homeostasis. J Clin Invest 2002; 110:11339. First citation in article

    16.  Institute for Laboratory Animal Research. Guide for the care and use of laboratory animals. Washington, DC: National Academy Press, 1996. First citation in article

    17.  Fedarko NS, Jain A, Karadag A, Van Eman MR, Fisher LW. Elevated serum bone sialoprotein and osteopontin in colon, breast, prostate, and lung cancer. Clin Cancer Res 2001; 7:40606. First citation in article

    18.  Fisher LW, Torchia DA, Fohr B, Young MF, Fedarko NS. Flexible structures of SIBLING proteins, bone sialoprotein, and osteopontin. Biochem Biophys Res Commun 2001; 280:4605. First citation in article

    19.  Haase AT, Henry K, Zupanic M, et al. Quantitative image analysis of HIV-1 infection in lymphoid tissue. Science 1996; 274:9859. First citation in article

    20.  Weber GF, Cantor H. The immunology of Eta-1/osteopontin. Cytokine Growth Factor Rev 1996; 7:2418. First citation in article

    21.  Zhang Z-Q, Schuler T, Cavert W, et al. Reversibility of the pathological changes in the follicular dendritic cell network with treatment of HIV-1 infection. Proc Natl Acad Sci USA 1999; 96:516972. First citation in article

    22.  Racz P, Tenner-Racz K, Kahl C, Feller A, Kern P, Dietrich M. Spectrum of morphologic changes of lymph nodes from patients with AIDS or AIDS-related complexes. Prog Allergy 1986; 37:81181. First citation in article

    23.  Chalifoux LV, Ringler DJ, King NW, et al. Lymphadenopathy in macaques experimentally infected with simian immunodeficiency virus (SIV). Am J Pathol 1987; 128:10410. First citation in article

    24.  Lane HC, Masur H, Edgar LC, Whalen G, Rook AH, Fauci AS. Abnormalities of B-cell activation and immunoregulation in patients with the acquired immunodeficiency syndrome. N Engl J Med 1983; 309:4538. First citation in article

    25.  Samuelsson A, Sonnorborg A, Heuts N, Coster J, Chiodi F. Progressive B cell apoptosis and expression of Fas ligand during human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 1997; 13:10318. First citation in article

    26.  Shirai A, Cosentino M, Leitman-Klinman SF, Klinman DM. Human immunodeficiency virus infection induces both polyclonal and virus activation. J Clin Invest 1992; 89:5616. First citation in article

    27.  Zamarchi R, Barelli A, Borri A, et al. B cell activation in peripheral blood and lymph nodes during HIV infection. AIDS 2002; 16:121726. First citation in article

    28.  Mestas J, Hughes CCW. Of mice and not men: differences between mouse and human immunology. J Immunol 2004; 172:27318. First citation in article

    29.  Monroe JG, Silberstein LE. HIV-mediated B-lymphocyte activation and lymphomagenesis. J Clin Immunol 1995; 15:618. First citation in article

    30.  Schnittman SM, Lane HC, Higgins SE, Folks T, Fauci AS. Direct polyclonal activation of human B lymphocytes by the acquired immune deficiency syndrome virus. Science 1986; 233:10846. First citation in article

    31.  De Melito A, Nilsson A, Titanji K, et al. Mechanisms of hypergammaglobulinemia and impaired antigen-specific humoral immunity in HIV-1 infection. Blood 2004; 103:21806. First citation in article

    32.  O'Regan AW, Hayden JM, Berman JS. Osteopontin augments CD3-mediated interferon- and CD40 ligand expression by T cells, which results in IL-12 production from peripheral blood mononuclear cells. J Leukoc Biol 2000; 68:495502. First citation in article

    33.  Kiefer MC, Bauer DM, Barr PJ. The cDNA and derived amino acid sequence for human osteopontin. Nucleic Acids Res 1989; 17:3306. First citation in article

    34.  Young MF, Kerr JM, Termine JD, et al. cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN). Genomics 1990; 7:491502. First citation in article

    35.  Fisher LW, Yopung MF, Kozak CA, Dixon MJ. Mapping of the human and mouse sialoprotein and osteopontin loci. Mamm Genome 1996; 7:14951. First citation in article

    36.  Zhang Z-Q, Wietgrefe SW, Li Q, et al. Roles of substrate availability and infection of resting and activated CD4+ T cells in transmission and acute simian immunodeficiency virus infection. Proc Natl Acad Sci USA 2004; 101:56405. First citation in article

日期:2007年5月15日 - 来自[2005年第191卷第19期]栏目

Mobilization of Plasmacytoid and Myeloid Dendritic Cells to Mucosal Sites in Children with Respiratory Syncytial Virus and Other Viral Respiratory Infections

    Baylor Institute for Immunology Research
    Division of Pediatric Infectious Diseases, Department of Pediatrics, University of Texas Southwestern Medical Center at Dallas and Children's Medical Center Dallas, Dallas

    Background.

    Respiratory syncytial virus (RSV) is the principal etiologic agent of bronchiolitis and viral pneumonia in infants and young children. Yet, many aspects of its immunopathogenesis are not well understood.

    Methods.

    We analyzed the immune cells that are mobilized by RSV and other respiratory viruses, by studying nasal wash samples from children hospitalized with acute viral respiratory infections.

    Results.

    RSV mobilizes virtually all blood immune cells, including myeloid dendritic cells (DCs) and plasmacytoid DCs (pDCs), to the nasal mucosa. DCs were also mobilized to the nasal mucosa of children with other viral respiratory infections. The increased number of pDCs in the nasal compartment significantly correlates with RSV load (P = .022), and it is associated with a significant decrease in the number of pDCs in the blood (P = .007). The influx of DCs in the nasal mucosa is not transient, as even higher numbers of both DC subsets were found in respiratory secretions weeks after the acute symptoms of RSV infection had resolved. Immunochemistry analysis of respiratory samples has demonstrated the presence of the RSV fusion protein within HLA-DRpositive cells.

    Conclusion.

    Infection with RSV and other respiratory viruses mobilizes DCs to the site of viral entry.

    Control of viral infections represents a formidable challenge for the immune system. Mucosal viral infections are controlled by (1) preformed local and circulating antibodies [1, 2], (2) innate immunity mechanisms (such as local production of interferon [IFN] [35]), and (3) adaptive immunity mechanisms (such as cytotoxic responses [1] and antibody-secreting plasma cells [6, 7]).

    Respiratory syncytial virus (RSV) is the leading viral respiratory pathogen in young children [811]. RSV infection does not lead to the development of protective immunity, and repeated infections are common. Additionally, there is a strong association between RSV bronchiolitis in infancy and recurrent wheezing [1216].

    The inflammatory response initiated by RSV infection likely contributes to the manifestations of RSV disease [1721]. Little is known about the mobilization of the immune effectors and regulators at the site of viral entry (the nasal mucosa) in humans. Neutrophils were the predominant leukocyte found in both bronchoalveolar lavage and nasopharyngeal specimens from infants with RSV bronchiolitis, although lymphocytes and monocytes were also identified [2224].

    Despite considerable efforts, no RSV vaccine is currently available [25]. A better understanding of the interplay of RSV with immune cells may facilitate the development of an effective vaccine. Given the critical role of dendritic cells (DCs) in the initiation of immune responses, it is important to understand the relationship between RSV infection and DCs.

    DCs constitute a complex system of cells that induce and control immune responses [2630]. Two subsets of DC precursors circulate in the blood: lineage-negative CD11c+ myeloid DCs (mDCs) and CD11c- interleukin (IL)3R+ plasmacytoid DCs (pDCs) [29, 31], which produce large amounts of type I IFN in response to viruses [32, 33]. pDCs have been found in lymphoid organs [3436] and in increased numbers in allergen-challenged nasal mucosa [37] and in the skin of patients with systemic lupus erythematosus [38].

    Viruses employ many different strategies to escape the immune system, including targeting DCs and subverting their function [39, 40]. The measles virus, another paramyxovirus, modulates release of cytokines by DCs [41, 42] and renders DCs cytotoxic through the up-regulation of both FasL/CD95L and tumor necrosis factorrelated apoptosis-inducing ligand [43]. There is little information concerning the interplay of RSV with DCs. Therefore, we have analyzed the mDC and pDC subsets in children hospitalized with RSV infection and other viral respiratory infections. The present study demonstrates that both mDCs and pDCs are recruited to the site of viral replication in the respiratory tract.

    PATIENTS, MATERIALS, AND METHODS

    Patient population.

    Inclusion criteria for enrollment into the RSV group included the following: age <15 months, illness requiring hospitalization, and diagnosis of acute RSV infection by direct fluorescent antibody (DFA; Diagnostic Hybrids) test and/or viral culture (in HEp-2 or A549 cells). Our viral control group included patients with acute infections caused by respiratory viruses other than RSV, isolated from nasal wash samples by culture and/or identified by DFA test. DFA tests and viral cultures, which are routinely performed by the clinical virology laboratory, identified RSV; influenza A and B; parainfluenza 1, 2, and 3; adenovirus; and rhinovirus. Our control population consisted of healthy infants with no history of upper respiratory illness within the preceding 4 weeks. These children were typically identified in the operating room while undergoing elective surgical procedures that did not involve the respiratory tract. Despite the lack of respiratory symptoms, both DFA tests and viral culture of nasal wash samples were performed at enrollment, for all the healthy control children and for all patients with RSV infection who had undergone follow-up evaluations. Exclusion criteria for all groups included the following: age >15 months, receipt of immunosuppressive medications, and history of chronic lung disease. Informed consent was obtained from the parents of all patients at enrollment into the study, and the institutional review board at the University of Texas Southwestern Medical Center approved the study.

    Collection of nasal wash samples and cell isolation.

    Nasal wash samples were collected from patients by nasal suctioning, in accordance with a validated protocol [44]. A standardized volume of 3 mL of viral transport media (Bartels) at 4°C was then added, and the sample was maintained on ice. The sample was then centrifuged for 10 min at 300 g at 4°C. The cell/mucus pellet was resuspended in PBS/2% fetal calf serum at 4°C (Sigma) and centrifuged again, as above. This was repeated until no visible mucus clumps remained in the cell/mucus solution. The sample was filtered over a Filcon 100-m filter (Dako). Viable cells were visualized by trypan blue exclusion and counted by use of a Reichert Bright Line hemocytometer.

    Cell staining for flow-cytometric analysis.

    For nasal wash cell staining, 200,000 cells/tube were incubated with antibodies for 30 min, rinsed with PBS, centrifuged at 300 g for 10 min, and resuspended in 1% paraformaldehyde. For blood studies, whole blood was collected in tubes containing acid citrate dextrose. For staining, 100 L of blood and 310 L of each antibody were incubated for 30 min. The blood was then lysed with FACS Lysing Solution (BD Biosciences), rinsed with PBS, centrifuged at 300 g for 10 min, and resuspended in 1% paraformaldehyde. Samples were then acquired on a FACSCalibur flow cytometer and analyzed with CellQuest software (BD Biosciences).

    The following fluorochrome-conjugated antihuman antibodies were used for both nasal wash and whole-blood stainings: LINEAGEfluorescein isothiocyanate (FITC) cocktail (containing CD3, CD14, CD16, CD19, CD20, and CD56), CD123phycoerythrin (PE), HLA-DRperidin chlorophyll protein (PerCP), CD11callophycocyanin (APC), CD4-FITC, CD8-PE, CD3-PerCP, and CD14-APC (BD Biosciences). In selected experiments, nasal wash cells were also stained with monoclonal antibody (MAb) directed against the fusion protein of RSV (Fitzgerald Industries International).

    Quantification of RSV in nasal wash samples.

    Quantitative RSV cultures were performed using the standard plaque assay technique, as described elsewhere [23, 44].

    Quantification of cytokines and chemokines in nasal wash samples.

    Concentrations of cytokines in nasal wash samples were measured by Luminex XMAP technology (Luminex), by use of commercially available kits (Upstate USA), following the manufacturers' instructions.

    Confocal microscopy.

    In several patients with RSV infection, cells from respiratory secretions were mounted onto slides and stained with MAbs directed against HLA-DRFITC and RSV fusion protein (conjugated to Texas Red). Cells were then visualized by confocal microscopy (Leica TCS SP confocal microscope with a Planapo 63/1.32X objective).

    Statistical analysis.

    The nonparametric Mann-Whitney U test or the parametric unpaired t test was used, as appropriate, to compare numbers of DCs and concentrations of cytokines between groups. The Wilcoxon signed rank test was used to compare numbers of DCs in patients with acute versus resolved RSV infection. Spearman's coefficient was used for correlations.

    RESULTS

    Patient enrollment.

    Twenty-one patients with acute RSV infection, 8 with other acute viral respiratory infections, and 10 healthy control children were enrolled between December 2000 and February 2003 (table 1). All patients with acute RSV infection had symptoms of bronchiolitis requiring hospitalization. During the acute phase, they were treated symptomatically with oxygen, intravenous fluids, and -adrenergic agents for variable periods of time, but they did not receive antiviral agents or corticosteroids. Age distribution was similar between the 3 groups. Among the patients with other acute viral respiratory infections, 4 had parainfluenza and 3 had influenza (2 influenza B and 1 influenza A) respiratory infections requiring hospitalization. These patients manifested respiratory symptoms including cough, nasal congestion, hypoxia, and bronchiolitis. Another patient in this group was an asymptomatic infant initially enrolled in the control group whose nasopharyngeal viral culture later yielded cytomegalovirus (CMV). All patients with acute viral respiratory infections were enrolled during the same months of the year.

    mDCs, pDCs, monocytes, T cells, and B cells in nasal wash samples from patients with viral respiratory infections.

    Flow-cytometric analysis demonstrated that CD14+ monocytes, CD3+CD4- T cells, CD3+CD4+ T cells, and CD20+ and CD19+ B cells can be identified in nasal wash samples from patients with acute RSV infection (figure 1A1C). Neutrophils can also be found, as determined by morphological analysis of cytospins and Giemsa-stained cells (data not shown). This infiltrate was not due to bleeding, because (1) no bleeding was seen at the time samples were collected, (2) the red blood cell (RBC) : white blood cell (WBC) ratio was considerably lower in nasal wash samples than in blood samples (the highest nasal wash RBC : WBC ratio was 25 : 1, but most were much lower), and (3) immune effectors were abundant in nasal wash samples that contained no RBCs.

    Increase of mDCs in nasal wash samples and decrease in blood samples from children with acute viral respiratory infections.

    Using the parameters described above, we found that 27 of 29 evaluated patients with acute viral respiratory infections had mDCs in nasal wash samples (figure 2A), with a median of 2400 mDCs/nasal wash sample (range, 042,000 mDCs/nasal wash sample). In contrast, the healthy control children had very low numbers of mDCs in nasal wash samples (median, 45 mDCs/nasal wash sample; range, 01700 mDCs/nasal wash sample; P < .001, compared with all patients with viral infections). Of the 21 patients with acute RSV infection, 19 had mDCs in nasal wash samples (median, 1932 mDCs/nasal wash sample; range, 013,400 mDCs/nasal wash sample; P = .0041, compared with healthy control children). The 8 patients with other viral respiratory infections also had mDCs in nasal wash samples (median, 6665 mDCs/nasal wash sample; range, 57842,000 mDCs/nasal wash sample). The numbers were significantly different from those in healthy control children (P = .0014), but not from those in patients with RSV infection (P = .339).

    Increase of pDCs in nasal wash samples and decrease in blood samples from patients with acute viral respiratory infections.

    Twenty-three of 29 patients with acute viral respiratory infections had pDCs in nasal wash samples (median, 760 pDCs/nasal wash sample; range, 032,200 pDCs/nasal wash sample) (figure 3A). Five of 10 healthy control children also had pDCs in nasal wash samples, although at much lower numbers (median, 6 pDCs/nasal wash sample; range, 0680 pDCs/nasal wash sample; P = .0052, compared with patients with other viral respiratory infections). Fifteen of 21 patients with acute RSV infection had pDCs in nasal wash samples (median, 490 pDCs/nasal wash sample; range, 04480 pDCs/nasal wash sample; P = .043, compared with healthy control children). A positive correlation between the number of pDCs and the number of mDCs in nasal wash samples was identified (P < .01). All 8 patients with other viral respiratory infections had pDCs in nasal wash samples (median, 1094 pDCs/nasal wash sample; range, 10032,200 pDCs/nasal wash sample; P = .0003, compared with healthy control children).

    Increased concentrations of IL-6, IL-8, and macrophage inflammatory protein (MIP)1 in nasal wash samples from patients with RSV infection.

    We next analyzed the concentrations of several cytokines and chemokines in the respiratory tract. Concentrations of IL-6, IL-8, and MIP-1 were significantly increased in nasal wash samples from patients with RSV infection, compared with those in nasal wash samples from healthy control children (figure 4A). Concentrations of IL-8 were also significantly increased in nasal wash samples from patients with RSV infection, compared with those in nasal wash samples from patients with other viral respiratory infections. Among the cytokines and chemokines measured, only MIP-1 was significantly increased in nasal wash samples from patients with other viral respiratory infections, but a trend for increased concentrations of IL-6 was also observed. No significant differences in the concentrations of IL-4, IL-5, or IFN- were observed (figure 4B).

    Among the patients with RSV infection, there was a positive correlation between numbers of mDCs and concentrations of IL-6 in nasal wash samples (r = 0.5; P = .04). Although this correlation was not present in the control group, numbers of mDCs did strongly correlate with concentrations of MIP-1 (r = 0.77; P = .017). In patients with other acute viral respiratory infections, numbers of mDCs significantly correlated with concentrations of IL-8 (r = 0.88; P = .03), and there was a marked trend for increased concentrations of MIP-1 (r = 0.81; P = .058).

    The number of pDCs in nasal wash samples also increased after resolution of acute RSV infection. In a comparison of the patients with RSV infection as a group, the median number of pDCs in nasal wash samples increased from 760 pDCs/nasal wash sample during acute infection to 11,763 pDCs/nasal wash sample after resolution of infection, representing a 15-fold increase. By use of paired evaluations of only the patients with RSV infection from whom follow-up samples were available, the increase in the number of pDCs in nasal wash samples was significant (P = .047, Wilcoxon signed rank test; P = .03 [RSV-04 not included in analysis]). Only 1 patient (RSV-04) had a decreased number of pDCs in nasal wash samples after resolution of acute RSV infection. This patient was indeed receiving daily inhaled steroids after hospitalization for RSV infection. It is interesting to note that this patient still had an increase in mDCs in nasal wash samples, which is consistent with the finding that steroids block the generation of pDCs from hematopoietic progenitor cells more efficiently than that of mDCs (A.K.P., unpublished observations). No other evaluated patients received any form of steroids.

    The pDC subset represented a larger percentage of the cellular infiltrate in the follow-up phase as well, although it was not as markedly increased as was the mDC subset (median, 0.11% after resolution of infection vs. 0.01% during acute infection; P = .14). There was a positive correlation between the increase in numbers of mDCs and pDCs in nasal wash samples after resolution of acute RSV infection (r = 0.93; P = .007). No evidence of RSV or other viruses was detected by routine viral cultures, DFA tests, or RSV plaque assays performed during the follow-up evaluations.

    Expression of RSV proteins by HLA-DRpositive cells from the respiratory tract.

    Next, we wondered whether nasal DCs would carry RSV. To investigate this question, we stained unsorted nasal and tracheal wash cells from RSV-infected patients with antibodies directed against HLA-DR and RSV fusion protein. Respiratory samples from 2 patients demonstrated HLA-DRpositive cells that also expressed RSV fusion protein (figure 7). A few HLA-DRnegative cells were found to be positive for RSV fusion protein, and not all HLA-DRpositive cells expressed RSV fusion protein.

    DISCUSSION

    RSV infection is a major cause of morbidity in infants and children, indicating that it is not efficiently controlled by the immune system. Pathogens affect different components of the immune system for their survival and replication. In particular, DCs are targeted by many viruses, including HIV [47], dengue virus [48, 49], and CMV [50]. This prompted the present study, since very little is known about the interactions between RSV and the DC system, most particularly in humans, the primary host of RSV.

    We initiated the present study by assessing what happens at the actual site of RSV entry/infection, the nasal cavity. We are naturally limited in the scope of our investigation by 2 parameters: (1) the young age of the patients (<15 months; median, 3 months in the RSV group); and (2) the small sample material to analyze (3-mL nasal wash samples), in which viscosity makes analysis of infiltrating cells challenging, and the limited volume of blood samples. Despite these limitations, several important conclusions can be made.

    First, as reported elsewhere [22], in nasal wash samples, we found virtually all the immune effectors, including T cells, B cells, monocytes, neutrophils, and, more importantly, both pDCs and mDCs, the focus of the present study. The results demonstrate that RSV attracts both mDCs and pDCs to the site of viral infection. The number of pDCs, and, to a lesser extent, that of mDCs, positively correlates with RSV load. The number of mDCs at the site of RSV infection (median, 1932 mDCs) is significantly higher than the number of pDCs (median, 490 pDCs). This may be due to the considerable phenotypic and morphological alterations that pDCs undergo after maturation. Unfortunately, no reagents are currently available that allow the identification of mature pDCs, and these cells likely remain uncounted. No CD83+ cells could be detected, suggesting that mature DCs might remain associated with the tissue. The attraction of both DC subsets to the nasal mucosa is not specific to RSV infection, as the 8 patients with other viral respiratory infections also had similar findings.

    With regard to mDCs, their increase in nasal wash samples was associated with a decrease in blood samples. This suggestsit is difficult to formally demonstrate without controlled challenge studiesthat the increase of mDCs in nasal mucosa results from their migration from the blood. The increased presence of mDCs in virus-infected nasal mucosa in humans is reported here for the first time. However, this finding is consistent with earlier studies performed in rats, in which Moraxella catarrhalis or Sendai virus recruited major histocompatibility complex (MHC) class IIpositive cells (putative DCs) into the airway epithelium [51, 52].

    In its consideration of pDCs, the present study is, to our knowledge, the first study to report their attraction to a mucosal site of viral replication. This could be viewed as an expected finding, since pDCs are considered to represent an early barrier to viral replication through their ability to secrete large amounts of IFN- in response to viral challenge. Attraction of pDCs to the nasal mucosa in humans has been reported under a different pathological conditionthat is, in allergic patients challenged with the relevant allergens [37]. Furthermore, studies of mice have reported the presence of cells with characteristics of pDCs in the bronchi of mice challenged with a leishmanial antigen [53]. These MHC class IIpositive cells were long lasting, which is consistent with our observation of long-lasting infiltration of DCs into the nasal mucosa as late as 8 weeks after resolution of acute RSV infection. More-recent studies have confirmed that pDCs have a long half-life in vivo [54], a finding that contrasts with their extreme propensity to apoptose after isolation [34]. In humans, pDCs have also been found to infiltrate cutaneous lesions caused by varicella-zoster virus [55]. Whether the infiltrating cells are long-lasting cells attracted at the time of acute infection or a set of new cells attracted by long-acting mechanisms initiated by viral infection represents a complex challenge to address in our patient population. Since we evaluated only patients with RSV infection after resolution of acute symptoms, we do not know whether the persistence of DCs is specific to RSV infection. It will be important to evaluate patients with other viral respiratory infections in future studies.

    DC subsets in blood are reduced and impaired in patients with HIV infection [5659]. The number of circulating pDCs correlated inversely with HIV load and the occurrence of opportunistic infections [58, 60]. In the present study, the number of pDCs in blood samples did not correlate with the RSV load measured in the respiratory tract. The decrease in pDCs in blood samples during acute RSV infection suggests that pDCs are recruited to the site of viral entry, the nasal mucosa. It is unknown whether RSV infects pDCs.

    We have made significant attempts to determine whether the DCs present in the nasal wash samples were functional. Unfortunately, it is difficult to isolate sufficient cell numbers from the small viscous nasal wash samples, to complete such studies. Therefore, we will be limited to in vitro studies to determine how RSV might affect the functions of human DCs. This will be important to investigate, since RSV may interfere with DC-induced T cell activation and differentiation in a fashion that leads to characteristics of disease. Indeed, it has recently been shown that RSV induces human cord bloodderived mDCs to secrete IL-10, IL-11, and prostaglandin E2, whereas influenza primarily induces generation of IL-12 in mDCs [61].

    We found significantly increased concentrations of IL-6, IL-8, and MIP-1 in nasal wash samples from patients with RSV infection. Despite the small number of patients in the group with other viral respiratory infections, the concentrations of MIP-1 in their nasal wash samples were also increased, and there was a clear trend for increased concentrations of IL-6. Concentrations of IL-8, however, were significantly greater in patients with RSV infection than in patients with other viral respiratory infections. In addition, the correlation between numbers of mDCs and concentrations of IL-6 was detected only in patients with RSV infection. Although it is difficult to draw conclusions from these correlations, we can speculate that the balance of cytokines/chemokines and DCs that exists in healthy control children is altered during RSV infection. Indeed, the correlation between numbers of mDCs in the mucosa and concentrations of MIP-1 observed in healthy control children was absent in patients with RSV infection.

    Although we were unable to address the functional status of the DCs in nasal wash samples in patients with RSV infection, we have demonstrated that RSV antigen can be detected within HLA-DRpositive cells with the morphology of DCs. Further studies will be required to confirm that these cells are indeed DCs and to determine whether RSV replicates within these cells or whether RSV particles are simply captured from the mucosal microenvironment.

    In conclusion, we have shown that RSV infection results in mobilization of DCs to the site of viral entry. How RSV affects the functions of these immune cells will be the focus of important future studies that may shed light on the pathogenesis of this common infection.

    Acknowledgments

    We extend special thanks to Virginia Pascual, for many discussions and for reviewing our data; Elizabeth Kraus and Sebastien Coquery, for their superb technical assistance with the flow-cytometric analysis of our patient samples; Sandra Clayton, for her expertise in confocal microscopy; and Jeanine Hatfield, for her efforts in viral quantitation and numerous other aspects of sample processing. We also thank Edsel Arce, for his assistance, and Lonnie Roy and Naveed Ahmed, for their input regarding the statistical analysis of the data. We also acknowledge Michael Ramsay, for his support of this project.

    References

    1.  Guidotti LG, Chisari FV. Noncytolytic control of viral infections by the innate and adaptive immune response. Annu Rev Immunol 2001; 19:6591. First citation in article

    2.  Freihorst J, Ogra PL. Mucosal immunity and viral infections. Ann Med 2001; 33:1727. First citation in article

    3.  Biron CA, Nguyen KB, Pien GC, Cousens LP, Salazar-Mather TP. Natural killer cells in antiviral defense: function and regulation by innate cytokines. Annu Rev Immunol 1999; 17:189220. First citation in article

    5.  Taniguchi T, Takaoka A. The interferon-/ system in antiviral responses: a multimodal machinery of gene regulation by the IRF family of transcription factors. Curr Opin Immunol 2002; 14:1116. First citation in article

    6.  Bachmann MF, Zinkernagel RM. Neutralizing antiviral B cell responses. Annu Rev Immunol 1997; 15:23570. First citation in article

    7.  Slifka MK, Ahmed R. Long-term humoral immunity against viruses: revisiting the issue of plasma cell longevity. Trends Microbiol 1996; 4:394400. First citation in article

    8.  Chanock RM, Parrorr RH. Acute respiratory disease in infancy and childhood: present understanding and prospects for prevention. Pediatrics 1965; 36:2139. First citation in article

    9.  Macasaet FF, Kidd PA, Bolano CR, Wenner HA. The etiology of acute respiratory infections. 3. The role of viruses and bacteria. J Pediatr 1968; 72:82939. First citation in article

    10.  Glezen WP, Taber LH, Frank AL, Kasel JA. Risk of primary infection and reinfection with respiratory syncytial virus. Am J Dis Child 1986; 140:5436. First citation in article

    11.  Leader S, Kohlhase K. Respiratory syncytial viruscoded pediatric hospitalizations, 1997 to 1999. Pediatr Infect Dis J 2002; 21:62932. First citation in article

    12.  Rooney JC, Williams HE. The relationship between proved viral bronchiolitis and subsequent wheezing. J Pediatr 1971; 79:7447. First citation in article

    13.  Sigurs N, Bjarnason R, Sigurbergsson F, Kjellman B. Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am J Respir Crit Care Med 2000; 161:15017. First citation in article

    14.  Welliver RC, Sun M, Rinaldo D, Ogra PL. Predictive value of respiratory syncytial virusspecific IgE responses for recurrent wheezing following bronchiolitis. J Pediatr 1986; 109:77680. First citation in article

    15.  Stein RT, Sherrill D, Morgan WJ, et al. Respiratory syncytial virus in early life and risk of wheeze and allergy by age 13 years. Lancet 1999; 354:5415. First citation in article

    16.  Culley FJ, Pollott J, Openshaw PJ. Age at first viral infection determines the pattern of T cellmediated disease during reinfection in adulthood. J Exp Med 2002; 196:13816. First citation in article

    17.  Graham BS, Rutigliano JA, Johnson TR. Respiratory syncytial virus immunobiology and pathogenesis. Virology 2002; 297:17. First citation in article

    18.  Openshaw PJ, Dean GS, Culley FJ. Links between respiratory syncytial virus bronchiolitis and childhood asthma: clinical and research approaches. Pediatr Infect Dis J 2003; 22(Suppl 2):S5864; discussion S645. First citation in article

    19.  Holt PG, Sly PD. Interactions between RSV infection, asthma, and atopy: unraveling the complexities. J Exp Med 2002; 196:12715. First citation in article

    20.  Miller AL, Strieter RM, Gruber AD, Ho SB, Lukacs NW. CXCR2 regulates respiratory syncytial virusinduced airway hyperreactivity and mucus overproduction. J Immunol 2003; 170:334856. First citation in article

    21.  Lukacs NW, Tekkanat KK, Berlin A, et al. Respiratory syncytial virus predisposes mice to augmented allergic airway responses via IL-13mediated mechanisms. J Immunol 2001; 167:10605. First citation in article

    22.  Everard ML, Swarbrick A, Wrightham M, et al. Analysis of cells obtained by bronchial lavage of infants with respiratory syncytial virus infection. Arch Dis Child 1994; 71:42832. First citation in article

    23.  Sheeran P, Jafri H, Carubelli C, et al. Elevated cytokine concentrations in the nasopharyngeal and tracheal secretions of children with respiratory syncytial virus disease. Pediatr Infect Dis J 1999; 18:11522. First citation in article

    24.  Aherne W, Bird T, Court SD, Gardner PS, McQuillin J. Pathological changes in virus infections of the lower respiratory tract in children. J Clin Pathol 1970; 23:718. First citation in article

    25.  Polack FP, Teng MN, Collins PL, et al. A role for immune complexes in enhanced respiratory syncytial virus disease. J Exp Med 2002; 196:85965. First citation in article

    26.  Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature 1998; 392:24552. First citation in article

    27.  Guermonprez P, Valladeau J, Zitvogel L, Thery C, Amigorena S. Antigen presentation and T cell stimulation by dendritic cells. Annu Rev Immunol 2002; 20:62167. First citation in article

    28.  Moser M, Murphy KM. Dendritic cell regulation of TH1-TH2 development. Nat Immunol 2000; 1:199205. First citation in article

    29.  Shortman K, Liu YJ. Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002; 2:15161. First citation in article

    30.  Steinman RM. The control of immunity and tolerance by dendritic cell. Pathol Biol (Paris) 2003; 51:5960. First citation in article

    31.  Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol 2000; 18:767811. First citation in article

    32.  Siegal FP, Kadowaki N, Shodell M, et al. The nature of the principal type 1 interferonproducing cells in human blood. Science 1999; 284:18357. First citation in article

    33.  Cella M, Jarrossay D, Facchetti F, et al. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 1999; 5:91923. First citation in article

    34.  Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, Liu YJ. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)3 and CD40-ligand. J Exp Med 1997; 185:110111. First citation in article

    35.  Weijer K, Uittenbogaart CH, Voordouw A, et al. Intrathymic and extrathymic development of human plasmacytoid dendritic cell precursors in vivo. Blood 2002; 99:27529. First citation in article

    36.  Bendriss-Vermare N, Barthelemy C, Durand I, et al. Human thymus contains IFN-producing CD11c-, myeloid CD11c+, and mature interdigitating dendritic cells. J Clin Invest 2001; 107:83544. First citation in article

    37.  Jahnsen FL, Lund-Johansen F, Dunne JF, Farkas L, Haye R, Brandtzaeg P. Experimentally induced recruitment of plasmacytoid (CD123high) dendritic cells in human nasal allergy. J Immunol 2000; 165:40628. First citation in article

    38.  Farkas L, Beiske K, Lund-Johansen F, Brandtzaeg P, Jahnsen FL. Plasmacytoid dendritic cells (natural interferon-/producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol 2001; 159:23743. First citation in article

    39.  Tortorella D, Gewurz BE, Furman MH, Schust DJ, Ploegh HL. Viral subversion of the immune system. Annu Rev Immunol 2000; 18:861926. First citation in article

    40.  Palucka K, Banchereau J. How dendritic cells and microbes interact to elicit or subvert protective immune responses. Curr Opin Immunol 2002; 14:42031. First citation in article

    41.  Grosjean I, Caux C, Bella C, et al. Measles virus infects human dendritic cells and blocks their allostimulatory properties for CD4+ T cells. J Exp Med 1997; 186:80112. First citation in article

    42.  Fugier-Vivier I, Servet-Delprat C, Rivailler P, Rissoan MC, Liu YJ, Rabourdin-Combe C. Measles virus suppresses cell-mediated immunity by interfering with the survival and functions of dendritic and T cells. J Exp Med 1997; 186:81323. First citation in article

    43.  Vidalain PO, Azocar O, Lamouille B, Astier A, Rabourdin-Combe C, Servet-Delprat C. Measles virus induces functional TRAIL production by human dendritic cells. J Virol 2000; 74:5569. First citation in article

    44.  Malley R, DeVincenzo J, Ramilo O, et al. Reduction of respiratory syncytial virus (RSV) in tracheal aspirates in intubated infants by use of humanized monoclonal antibody to RSV F protein. J Infect Dis 1998; 178:155561. First citation in article

    45.  Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J. Induction of dendritic cell differentiation by IFN- in systemic lupus erythematosus. Science 2001; 294:15403. First citation in article

    46.  Gill MA, Blanco P, Arce E, Pascual V, Banchereau J, Palucka AK. Blood dendritic cells and DC-poietins in systemic lupus erythematosus. Hum Immunol 2002; 63:117280. First citation in article

    47.  Steinman RM, Granelli-Piperno A, Pope M, et al. The interaction of immunodeficiency viruses with dendritic cells. Curr Top Microbiol Immunol 2003; 276:130. First citation in article

    48.  Tassaneetrithep B, Burgess TH, Granelli-Piperno A, et al. DC-SIGN (CD209) mediates dengue virus infection of human dendritic cells. J Exp Med 2003; 197:8239. First citation in article

    49.  Wu SJ, Grouard-Vogel G, Sun W, et al. Human skin Langerhans cells are targets of dengue virus infection. Nat Med 2000; 6:81620. First citation in article

    50.  Raftery MJ, Schwab M, Eibert SM, Samstag Y, Walczak H, Schonrich G. Targeting the function of mature dendritic cells by human cytomegalovirus: a multilayered viral defense strategy. Immunity 2001; 15:9971009. First citation in article

    51.  McWilliam AS, Nelson D, Thomas JA, Holt PG. Rapid dendritic cell recruitment is a hallmark of the acute inflammatory response at mucosal surfaces. J Exp Med 1994; 179:13316. First citation in article

    52.  McWilliam AS, Marsh AM, Holt PG. Inflammatory infiltration of the upper airway epithelium during Sendai virus infection: involvement of epithelial dendritic cells. J Virol 1997; 71:22636. First citation in article

    53.  Julia V, Hessel EM, Malherbe L, Glaichenhaus N, O'Garra A, Coffman RL. A restricted subset of dendritic cells captures airborne antigens and remains able to activate specific T cells long after antigen exposure. Immunity 2002; 16:27183. First citation in article

    54.  O'Keeffe M, Hochrein H, Vremec D, et al. Mouse plasmacytoid cells: long-lived cells, heterogeneous in surface phenotype and function, that differentiate into CD8+ dendritic cells only after microbial stimulus. J Exp Med 2002; 196:130719. First citation in article

    55.  Jahnsen FL, Farkas L, Lund-Johansen F, Brandtzaeg P. Involvement of plasmacytoid dendritic cells in human diseases. Hum Immunol 2002; 63:12015. First citation in article

    56.  Donaghy H, Pozniak A, Gazzard B, et al. Loss of blood CD11c+ myeloid and CD11c- plasmacytoid dendritic cells in patients with HIV-1 infection correlates with HIV-1 RNA virus load. Blood 2001; 98:25746. First citation in article

    57.  Grassi F, Hosmalin A, McIlroy D, Calvez V, Debre P, Autran B. Depletion in blood CD11c-positive dendritic cells from HIV-infected patients. AIDS 1999; 13:75966. First citation in article

    58.  Soumelis V, Scott I, Gheyas F, et al. Depletion of circulating natural type 1 interferonproducing cells in HIV-infected AIDS patients. Blood 2001; 98:90612. First citation in article

    59.  Donaghy H, Gazzard B, Gotch F, Patterson S. Dysfunction and infection of freshly isolated blood myeloid and plasmacytoid dendritic cells in patients infected with HIV-1. Blood 2003; 101:450511. First citation in article

    60.  Soumelis V, Scott I, Liu YJ, Levy J. Natural type 1 interferon producing cells in HIV infection. Hum Immunol 2002; 63:120612. First citation in article

    61.  Bartz H, Buning-Pfaue F, Turkel O, Schauer U. Respiratory syncytial virus induces prostaglandin E2, IL-10 and IL-11 generation in antigen presenting cells. Clin Exp Immunol 2002; 129:43845. First citation in article

日期:2007年5月15日 - 来自[2005年第191卷第7期]栏目

Importance of Myeloid Dendritic Cells in Persistent Airway Disease after Repeated Allergen Exposure

    Division of Cell Biology, Department of Pediatrics, National Jewish Medical and Research Center, Denver, Colorado

    ABSTRACT

    Rationale: There is conflicting information about the development and resolution of airway inflammation and airway hyperresponsiveness (AHR) after repeated airway exposure to allergen in sensitized mice.

    Methods: Sensitized BALB/c and C57BL/6 mice were exposed to repeated allergen challenge on 3, 7, or 11 occasions. Airway function in response to inhaled methacholine was monitored; bronchoalveolar lavage fluid inflammatory cells were counted; and goblet cell metaplasia, peribronchial fibrosis, and smooth muscle hypertrophy were quantitated on tissue sections. Bone marrow–derived dendritic cells were generated after differentiation of bone marrow cells in the presence of growth factors.

    Results: Sensitization to ovalbumin (OVA) in alum, followed by three airway exposures to OVA, induced lung eosinophilia, goblet cell metaplasia, mild peribronchial fibrosis, and peribronchial smooth muscle hypertrophy; increased levels of interleukin (IL)-4, IL-5, IL-13, granulocyte-macrophage colony–stimulating factor, transforming growth factor-1, eotaxin-1, RANTES (regulated on activation, normal T-cell expressed and secreted), and OVA-specific IgG1 and IgE; and resulted in AHR. After seven airway challenges, development of AHR was markedly decreased as was the production of IL-4, IL-5, and IL-13. Levels of IL-10 in both strains and the level of IL-12 in BALB/c mice increased. After 11 challenges, airway eosinophilia and peribronchial fibrosis further declined and the cytokine and chemokine profiles continued to change. At this time point, the number of myeloid dendritic cells and expression of CD80 and CD86 in lungs were decreased compared with three challenges. After 11 challenges, intratracheal instillation of bone marrow–derived dendritic cells restored AHR and airway eosinophilia.

    Conclusions: These data suggest that repeated allergen exposure leads to progressive decreases in AHR and allergic inflammation, through decreases in myeloid dendritic cell numbers.

    Key Words: airway hyperresponsiveness  chronic asthma  cytokine  dendritic cells  eosinophil

    Chronic inflammation of the airways with variable airflow limitation is responsible for the altered airway responsiveness seen in individuals with asthma to a variety of stimuli (1). Elevated serum IgE levels and inflammatory cell infiltration, especially of eosinophils, mast cells, and CD4+ T cells, appear to be involved in the pathogenesis of the disease (2–4). Much of our understanding of asthma points to a complex and multifactorial condition involving interactions between genetic factors and environmental stimuli. It has been argued that repeated exposure to airborne allergens, such as house dust mite or animal dander, contributes to the initiation and persistence of airway inflammation, which is believed to be the central abnormality resulting in airway damage and dysfunction (5, 6). Several studies identified increased muscle mass and airway wall thickening as determinants of airway hyperresponsiveness (AHR) (7, 8). This chronic airway inflammatory response, which is characteristic of asthma, can lead to airway remodeling, and structural alterations that may underlie some of the persistent manifestations of asthma. Indeed, a variety of cells, including epithelial cells, fibroblasts, and smooth muscle cells, in the chronic stages of asthma likely contribute through the secretion of various cytokines and chemokines that result in the irreversible fibrosis and remodeling seen in the airways of individuals with asthma (9, 10).

    In allergic diseases, such as atopic dermatitis and allergic asthma, allergen-specific T cells express a helper T-cell type 2 (Th2) phenotype (11). In animal models of acute allergic inflammation, Th2 cell–derived cytokines, notably interleukin (IL)-4, IL-5, IL-9, and IL-13 and C-C chemokine family members such as RANTES (regulated on activation, normal T-cell expressed and secreted) and eotaxin-1, are pivotal in the induction of eosinophilic airway inflammation, antigen-specific IgE production, and AHR (12). Although airway inflammation and Th2 cytokines and chemokines are undoubtedly a cornerstone of asthma, it is clear that the asthmatic response is more complex. The relative importance of these factors may vary according to the stage or duration of asthma. Much less is known about the pathogenesis of chronic airway eosinophilic inflammation and cytokine/chemokine production in long-standing asthma. Because no satisfactory disease-modifying treatment is currently available for chronic asthma, evaluation of the therapeutic effects of the modulation of cytokine/chemokine production in chronic disease is an important area of investigation (13). In this regard, an essential first step is to characterize the profile and kinetics of cytokine/chemokine production in a model system where allergen challenges are incremental, to identify potential therapeutic targets.

    Whereas the role of T cells has been fairly well described, much less information is available on the role of dendritic cells (DCs) in allergic airway inflammation. DCs have been thought to be an important cell type in the initiation of T-cell–mediated inflammation by priming naive T cells (14, 15). Several reports have identified a critical role for DCs in allergic airway inflammation (16, 17). DCs are subdivided on the basis of surface antigen expression. Each DC subtype may induce different stimulatory signals on T cells and on the development of allergic inflammation. For example, bone marrow–derived DCs (BMDCs) expressing a myeloid DC (mDC) phenotype prime T cells to specific antigen and induce their expansion (18). On the other hand, plasmacytoid DCs (pDCs) inhibit the development of effector T cells (19). The purpose of this study was to delineate the characteristics of allergic airway responses after repeated allergen challenge and the role of DCs in regulating these responses.

    METHODS

    Animals

    Female BALB/c and C57BL/6 mice were purchased at 8 to 12 wk of age from Jackson Laboratories (Bar Harbor, ME) and housed under specific pathogen–free conditions. The animals were maintained on an ovalbumin (OVA)-free diet. Experiments were conducted under a protocol approved by Institutional Animal Care and Use Committee of the National Jewish Medical and Research Center (Denver, CO).

    Protocols for OVA-induced Allergic Airway Inflammation

    Mice were sensitized on Days 1 and 14 by intraperitoneal injection of 20 μg of OVA (grade V; Sigma-Aldrich, St. Louis, MO) premixed with 2.25 mg of Al(OH)3 (Pierce Biotechnology, Rockford, IL) in 100 μl of phosphate-buffered saline (PBS). After sensitization, animals were exposed to aerosolized OVA (1% in saline) for 20 min/d on Days 28, 29, and 30 (3 challenges, short-term challenge), or continued to receive airway challenges on Days 36, 40, 44, and 48 (7 challenges), as well as on Days 52, 56, 60, and 64 (11 challenges; Figure 1). Forty-eight hours after the last OVA challenge (Day 32, 50, or 66) AHR was assessed and bronchoalveolar lavage (BAL) fluid, serum, and tissues were obtained for further analyses. Control groups consisted of nonsensitized but OVA-challenged animals.

    Assessment of Airway Function

    Airway function was assessed as previously described by measuring changes in lung resistance (RL) and dynamic compliance (Cdyn) in response to increasing doses of inhaled methacholine (MCh) (20).

    BAL

    Immediately after assessment of airway function, lungs were lavaged via the tracheal tube with 1 ml of Hanks' balanced salt solution at room temperature. Total leukocyte numbers were measured (Coulter Counter; Beckman Coulter, Fullerton, CA). Cytospin slides were stained with Leukostat (Fisher Diagnostics, Pittsburgh, PA) and differentiated by standard hematologic procedures in a blinded fashion.

    Lung Histopathology and Morphometric Analyses

    Lungs were fixed in 10% formalin and processed into paraffin. Mucus-containing goblet cells were detected by staining of paraffin sections (5-μm thick) with periodic acid–Schiff (PAS). Airway fibrosis was detected by staining of collagen with Sirius red. Airway smooth muscle cells were stained with immunoperoxidase, using anti–-smooth muscle actin monoclonal antibody (Sigma-Aldrich). Tissue-infiltrating eosinophils were identified by immunofluorescence staining of major basic protein as previously described using rabbit anti-mouse major basic protein (kindly provided by J. J. Lee, Mayo Clinic, Scottsdale, AZ) (20). CD4+ T cells were detected by immunoperoxidase staining of frozen lung tissue sections with a rat anti-mouse CD4 antibody (L3T4; BD Biosciences Pharmingen, San Diego, CA). As a control, rat IgG was used. Histologic analyses were performed in a blinded manner by light microscopy linked to an image capture system. The data were analyzed by quantitative morphometry, using Scion Image analysis software available as public domain software from the U.S. National Institutes of Health (http://rsb.info.nih.gov/nih-image/). Numbers of PAS-positive goblet cells, airway tissue–infiltrating eosinophils, and collagen (Sirius red staining) were determined only in cross-sectional areas of the airway wall. Tangential sections and airway wall areas adjacent to large blood vessels were excluded from the analysis. For smooth muscle and collagen analysis, the slice density function of the software was used to highlight pixels belonging to the staining, excluding intercellular space and unstained tissue structures, which fall within the stained collagen or smooth muscle areas, and expressed as square micrometers. To allow for comparisons, all measurements were normalized to the length of the basement membrane of the adjacent epithelium for each corresponding airway. Airways 250 to 500 μm in internal diameter were evaluated and 10 different sections were evaluated per animal. The obtained measurements were averaged for each animal and the mean values and standard errors were determined for each group.

    Measurement of BAL Fluid Cytokines and Chemokines

    Levels of cytokines and chemokines were determined by commercial ELISAs in accordance with the manufacturer instructions. ELISA kits for detection of IL-4, IL-5, IL-10, IL-12 (p70), and IFN- in supernatants were obtained from BD Biosciences Pharmingen. IL-13, transforming growth factor (TGF)-1, granulocyte-macrophage colony–stimulating factor (GM-CSF), eotaxin-1 and RANTES ELISA kits were purchased from R&D Systems (Minneapolis, MN). Before the TGF-1 assay, BAL fluid samples were acidified to activate any latent TGF-1 (21). The limits of detection for each assay were as follows: 4 pg/ml for IL-4 and IL-5; 10 pg/ml for IL-10, IL-12, and IFN-; 1.5 pg/ml for IL-13 and GM-CSF; 3 pg/ml for eotaxin-1 and RANTES; and 7 pg/ml for TGF-1.

    Measurement of OVA-specific Antibodies

    Serum levels of OVA-specific IgE, IgG1, and IgG2a were measured by ELISA as previously described (22).

    Lung Cell Isolation

    Lungs were dissected into small pieces and exposed to an enzymatic digestion solution containing collagenase V (175 IU/ml; Sigma-Aldrich, St. Louis, MO) in Hanks' balanced salt solution for 60 min. After enzymatic digestion, total lung leukocytes were further enriched by 35% Percoll (Sigma-Aldrich) gradient centrifugation. The pellets were resuspended in 5 ml of red blood cell lysing buffer (Sigma-Aldrich) for 10 min on ice. The cells were then washed twice and resuspended in PBS containing 1% bovine serum albumin.

    Flow Cytometry

    The surface phenotype of lung cells was analyzed with monoclonal antibodies (mAbs) in conjunction with a three- or four-color immunofluorescence test. To minimize nonspecific binding, 5 x 105 cells were incubated with 0.25 μg of Fc-blocking solution (CD16/CD32; clone 2.4G2) for 10 min and subsequently treated with fluorochrome-labeled mAbs. The mAbs included fluorescein isothiocyanate-, phycoerythrin-, peridinin chlorophyll protein-, or allophycocyanin-conjugated anti-CD11b (M1/70), anti-CD11c (HL3), anti–Ly-6G and anti–Ly-6C (Gr-1 RB6–8C5), anti-CD80 (16–10A1), anti-CD86 (GL1), and anti-CD45R/B220 (RA3–6B2; all obtained from BD Biosciences Pharmingen). For staining pDCs, anti–mPDCA-1 (JF05–1C2.4.1) was obtained from Miltenyi Biotec (Auburn, CA). For control staining, similarly labeled isotype-matched control antibodies were used. After washing, staining was analyzed by flow cytometry on a FACSCalibur using CellQuest software (BD Biosciences, Mountain View, CA).

    Generation and Transfer of BMDCs

    DCs were generated from bone marrow cells of naive BALB/c mice according to the procedure described by Inaba and coworkers (23), with some modification. In brief, bone marrow cells obtained from femurs and tibias of mice were placed in 75-cm2 flasks at 37°C in DC culture medium (RPMI 1640 containing 10% heat-inactivated fetal calf serum, 50 μM 2-mercaptoethanol, 2 mM L-glutamine, penicillin [100 U/ml], streptomycin [100 μg/ml; GIBCO; Invitrogen, Carlsbad, CA], recombinant mouse GM-CSF [10 ng/ml], and recombinant mouse IL-4 [10 ng/ml; R&D Systems]). Nonadherent cells were collected by aspirating the medium and transferred into fresh flasks. On Day 8, cells were pulsed with OVA (200 μg/ml) for 24 h and washed three times with PBS. More than 90% of the cells were mDCs (CD11c+CD11b+Gr-1–). For DC transfer after sensitization and 11 challenges with OVA, under anesthesia 1 x 106 OVA-pulsed BMDCs in 40 μl of PBS were instilled to BALB/c mice through the trachea, using fiberoptic illumination. Control groups of mice received PBS. Six days after DC transfer, mice were exposed to aerosolized OVA (1% in saline) for 20 min/d for 3 consecutive d. Forty-eight hours after the last challenge, AHR was assessed and BAL fluid and lung tissues were obtained.

    Statistical Analysis

    Mann-Whitney U tests were used to determine the levels of difference between all groups. Data were pooled from three independent experiments with four mice per group in each experiment (n = 12). Comparisons for all pairs were performed by Kruskal-Wallis test. Significance was assumed at p values less than 0.05. Values for all measurements were expressed as means ± SEM.

    RESULTS

    Airway Hyperresponsiveness

    Figure 2 illustrates the changes in lung resistance and dynamic compliance in response to inhaled MCh in both strains of mice after repeated allergen exposure. Exposure of sensitized mice to aerosolized allergen results in AHR to inhaled MCh. In sensitized BALB/c mice, short-term allergen exposure (i.e., three daily challenges) resulted in the development of increased AHR, detected by significant increases in lung resistance (Figure 2A) and decreases in dynamic compliance (Figure 2B), compared with similar challenge of nonsensitized animals. These results were strikingly different when sensitized mice were subjected to additional exposures of aerosolized allergen—in these mice there was little persistent alteration in airway function after seven allergen challenges. In fact, the results were similar to those of nonsensitized mice exposed to seven challenges alone. This absence of AHR was also observed after additional allergen exposure (11 challenges). In sensitized C57BL/6 mice the results were similar, with AHR developing after short-term exposure, but progressively declining with long-term allergen exposures (Figures 2C and 2D). As seen previously (24), the amounts of MCh required to elicit maximum responses in C57BL/6 mice were higher than needed in BALB/c animals.

    Inflammatory Cell Composition

    BAL fluid was examined in sensitized mice after 3, 7, and 11 inhalational challenges. In both BALB/c (Figure 3A) and C57BL/6 (Figure 3B) mice, significant increases in numbers of BAL fluid eosinophils were seen after three challenges. These numbers further increased in BALB/c mice exposed to seven challenges. However, after 11 challenges eosinophil numbers were reduced significantly in both strains. In both strains of mice, BAL fluid lymphocyte numbers were also increased after short-term challenge and the increases were sustained even after 11 challenges; in BALB/c mice the increases were also greater after long-term challenge. There were only small changes in neutrophil numbers. These results revealed some dissociation between AHR and the persistence of BAL fluid eosinophilia, at least after seven challenges of sensitized mice.

    Lung Tissue Analysis

    In parallel to the analysis of BAL fluid, lung tissue sections were immunolabeled with antibody to major basic protein to identify eosinophils in the lung tissue. As shown in Figures 4A and 4B, few eosinophils were detected in nonsensitized but challenged mice. In sensitized mice, after both short-term (three) and long-term (seven) challenges, lung eosinophilia developed and persisted. Interestingly, when these mice were monitored for an additional 2 wk (11 challenges), tissue eosinophilia was significantly decreased in the lung.

    When these same tissues were stained for the presence of CD4+ T lymphocytes, both short- and long-term challenge protocols resulted in marked increases in cell numbers, compared with the nonsensitized controls (Figures 4C and 4D). These increases in CD4+ T cells persisted through 11 challenges in both sensitized strains of mice.

    Goblet cell metaplasia and mucus hyperproduction were evaluated by PAS staining and quantification of positively stained cells. In nonsensitized mice of either strain, few positive cells were detected (Figures 4E and 4F, and Figure 5A). This contrasted with staining of tissue from sensitized and short- and long-term challenged mice, where the number of PAS-positive cells increased and was maintained, at least after 7 challenges (Figures 4E and 4F, and Figures 5B and 5C); after 11 challenges, the numbers of PAS-positive cells were decreased (Figures 4E and 4F, and Figure 5D). Thus, despite the persistence of BAL fluid and lung tissue eosinophilia, mucus hyperproduction, and infiltration of CD4+ lymphocytes, seven challenges with allergen via the airways was nonetheless associated with reduced AHR.

    Sirius red staining of the same tissues revealed a prominent subepithelial deposition of collagen in sensitized BALB/c and C57BL/6 mice after three and seven OVA challenges. However, after 11 challenges, the areas of collagen detected in the airway wall of sensitized mice were significantly reduced to levels that were comparable to those seen in nonsensitized but challenged control mice (Figures 4G and 4H, and Figures 5E–5H).

    After short-term allergen challenge, the area of the peribronchial smooth muscle layer was also increased in both sensitized BALB/c and C57BL/6 mice, when compared with challenged-only mice. However, this increase in airway smooth muscle area declined progressively with increasing allergen challenge (Figures 4I and 4J, and Figures 5I–5L).

    Cytokine/Chemokine Levels in BAL Fluid

    After sensitization and short-term challenge of both strains of mice, levels of the Th2 cytokines IL-4, IL-5, and IL-13 were significantly increased in BAL fluid (Figures 6A–6F). As previously reported (25), the BAL fluid levels of these cytokines were consistently higher in BALB/c mice (Figures 6A–6C) than in C57BL/6 mice (Figures 6D–6F). In contrast to short-term challenge, the levels of these cytokines decreased after additional (7 or 11) challenges.

    As previously reported (26), IL-10 levels in BALB/c mice decreased in the BAL fluid of sensitized animals compared with controls after short-term allergen challenge (Figures 6G and 6J). In contrast, after 7 and 11 challenges, levels of IL-10 increased significantly, to levels above those in controls of both strains. IFN- levels showed significant decreases after short-term challenge (Figures 6H and 6K), whereas IL-12 levels increased after the long-term challenges, more markedly in BALB/c mice than in C57BL/6 mice (Figures 6I and 6L). GM-CSF levels increased in both strains and were maintained even after 11 challenges in C57BL/6 mice (Figures 6M and 6O).

    Levels of total TGF-1 in BAL fluid were also elevated after three challenges in BALB/c mice or after three and seven challenges in C57/BL6 mice. However, these levels declined to control baseline levels after 11 challenges (Figures 6N and 6P). Among the chemokines assayed, eotaxin-1 levels increased after three and seven challenges in both strains, although levels were much higher in C57BL/6 mice (Figures 6Q and 6S). After 11 challenges, these levels fell significantly. RANTES levels also increased after 3 and 7 challenges in both strains, but returned to control values after 11 challenges (Figures 6R and 6T).

    Serum Antibody Levels

    OVA-specific IgE levels paralleled those of the Th2 cytokines, especially in sensitized BALB/c mice, with increases after three challenges followed by a significant decrease after long-term challenge (Figures 7A and 7D). In both strains, levels of OVA-specific IgG1 were maintained through the 11 challenges, as were levels of OVA-specific IgG2a (Figures 7B, 7C, 7E, and 7F).

    Lung DCs

    To determine whether repeated allergen challenge altered the number of DCs, lung cells were stained with anti–Gr-1 and anti-CD11c. In mice exposed to 11 challenges, the percentage of mDCs (CD11c+Gr-1–) was significantly decreased compared with that of mice receiving three challenges, returning to control baseline levels (percentage mDCs: 6.5 ± 0.7, 1.4 ± 0.2, and 1.5 ± 0.3 for sensitized mice exposed to 3 challenges, sensitized mice exposed to 11 challenges, and nonsensitized mice exposed to 3 challenges, respectively; n = 6; Figure 8A). Furthermore, expression of CD80 and CD86 on mDCs was significantly lower after 11 challenges, as was the mean fluorescence intensity (Figures 8B and 8C). On the other hand, numbers of pDCs (CD11c+ Gr-1+B220+PDCA-1+) were not significantly different between the groups exposed to 3 and 11 challenges (data not shown).

    Transfer of BMDCs

    Given that repeated allergen challenge, which led to the attenuation of AHR and Th2-mediated inflammation, was associated with decreased numbers of mDCs and lower expression of costimulatory molecules, we investigated whether intratracheal administration of OVA-pulsed mDCs could restore AHR and airway inflammation in recipient mice previously exposed to 11 challenges with OVA. As shown in Figure 9, the transfer of antigen-pulsed BMDCs restored AHR (Figure 9A) and BAL fluid eosinophilia (Figure 9B) compared with control mice.

    DISCUSSION

    Airway inflammation and AHR are hallmarks of allergic asthma. There are many reports in humans and in animal models linking airway inflammation and altered airway function to increases in Th2 cytokine and/or chemokine levels produced by immune cells (27, 28); the common theme is that these factors produce AHR indirectly through the recruitment of inflammatory cells. However, there remains significant controversy as to which cytokine(s) or chemokine(s) are essential to one or both processes. Despite their importance, only limited data are available with respect to the kinetics of development and maintenance or persistence of airway immune/inflammatory responses and AHR after repetitive allergen exposure of sensitized hosts. The primary purpose of the present study was to examine the kinetics of the development and resolution of AHR and airway inflammation after repetitive allergen exposure and relate these changes, when possible, to cytokine and chemokine responses.

    A characteristic and consistent feature of the murine response to sensitization and short-term airway allergen challenge is the development of AHR in response to inhaled MCh. Changes in lung function, measured in a variety of ways, have been demonstrated in both BALB/c and C57BL/6 mice. Although there are strain-related differences in the extent, for example, of changes in lung resistance versus compliance (24), or MCh reactivity (24, 25), AHR remains a consistent outcome of sensitization and short-term airway challenge. Extending airway challenge with the addition of four or eight more exposures over an additional 2 to 4 wk resulted in a marked attenuation of AHR in both strains of mice. In BALB/c mice, AHR was virtually abolished after seven challenges, whereas C57BL/6 mice showed a progressive decrease in AHR with increasing challenges. These decreases in AHR were observed throughout the MCh dose–response curve and in measures of both RL and Cdyn.

    These significant decreases in AHR occurred despite the maintenance of a significant increase in numbers of BAL fluid and lung tissue eosinophils through seven inhalation challenges with allergen. At face value, the data suggest the absence of a correlation between lung and BAL fluid eosinophilia and persistence of AHR. By 11 challenges, this dissociation was no longer apparent, as airway function normalized. The role of eosinophils in AHR is controversial in many species, including humans (29, 30) and mice (31, 32). Even after sensitization and short-term challenge, discrepancies have been reported (33). We and others (31, 34) have suggested that eosinophils and IL-5 are linked to AHR, in contrast to another report (35), at least when sensitization is followed by limited airway challenge (one to three intranasal or nebulized challenges). Moreover, with respect to the temporal sequence of these events, lung tissue eosinophilia has been better correlated with AHR than BAL fluid eosinophil numbers (24). Exceptions to the association of AHR and BAL fluid eosinophilia may be attributed to differences in the challenge protocol and readouts of lung function (36), although the exact reason(s) remain unclear. In a previous study, we also demonstrated that after secondary challenge, the role of eosinophils in the development of AHR became more complicated, and, to some extent, eosinophil independent (37).

    The persistence of lung and BAL fluid eosinophilia in the absence of AHR after seven challenges could be the result of several possibilities. One possibility is that the data simply reflect differences in the kinetics of individual responses. A second possibility is that eosinophilia is not linked to development of AHR; this is possible but less likely on the basis of the data discussed above. These discrepancies are reinforced by two contradictory reports using "eosinophil-less" mice (38, 39). A third alternative is that the eosinophils persist for longer periods in the lung tissue (34), but are no longer activated so as to result in AHR. As there are no good markers of eosinophil activation, this question remains open, and could explain the shift in kinetics or dissociation of eosinophilia and AHR. Since other factors (eotaxin-1, RANTES, and GM-CSF) affecting eosinophil recruitment, survival, and activation were elevated, at least after seven challenges, this may account for the persistent eosinophilia but an eosinophil activation factor present after short-term challenge, such as IL-5, was no longer available. However, our results showed that the levels of RANTES or GM-CSF in BAL fluid were not correlated to the persistence of AHR in mice after repeated OVA challenges.

    It is also striking that other responses implicated in the development of AHR also persisted after repetitive challenges despite the normalization of lung function in response to inhaled MCh. CD4+ T cells are thought to play a central role in the development of AHR and lung inflammation (40). Depletion of CD4+ T cells during the sensitization phase prevented the subsequent development of these responses (41). CD4+ T cells are also responsible for the production, at least in part, of the Th2 cytokines IL-4, IL-5, and IL-13 (11). Virtually all the pathophysiological manifestations of allergen-induced airway inflammation and AHR can be accounted for by these cytokines (42–44). After increasing numbers of challenges, the levels of these Th2 cytokines in BAL fluid were significantly reduced despite persistent elevation of CD4+ T cells in lung tissue. If CD4+ T cells are primarily responsible for Th2 cytokine production, one implication is that after long-term airway challenge, the functional activity of these lung T cells or their phenotype is altered. Although Th2 CD4+ T cells may be essential in the induction phase of allergic responses in the lung, their role over time may become modified (45). It is also possible that with repeated challenges they become "tolerized"—that is, no longer responsive to allergen— although we have no direct data supporting this conclusion.

    Despite the decreases in levels of IL-13 after seven challenges, goblet cell metaplasia/mucus hyperproduction persisted. However, after 11 challenges, this increase in PAS-positive cell numbers was also resolving. IL-13 appears essential for goblet cell metaplasia and mucus production (44). Rather than involving an undefined pathway maintaining this response over seven challenges, the results likely reflect a simple shift in kinetics, with levels of IL-13 falling more rapidly than the disappearance of PAS-positive cells. As observed with eosinophils, continued monitoring for an additional 2 wk showed a loss of these PAS-positive cells.

    In contrast to the decreases in Th2 cytokine production, increases were seen in other cytokine levels. IL-12 levels were increased in the BAL fluid of BALB/c and C57BL/6 mice, but with different kinetics. IL-12 is an important regulator of the balance between Th1 and Th2 cells (46). IL-12 induces production of IFN- (47), but we saw no concomitant increases in the levels of IFN- in BAL fluid. In similar murine models, IL-12 administration did inhibit lung eosinophilia and AHR, as well as decrease IL-4 and IL-5, and increase IFN- (48). IL-12 effects may also be IFN- independent (49). However, it seems unlikely that the dissociation between AHR and lung and BAL fluid eosinophilia after seven challenges was related to IL-12 levels. This dissociation was not seen after 11 challenges in both strains, and elevated IL-12 levels at this time point were associated with the inhibition of AHR as well as the attenuation of lung and BAL fluid eosinophilia.

    Common to both strains after long-term challenge was the increase in BAL fluid IL-10 levels. These IL-10 levels were sustained for a further 2 wk (11 challenges). In general, IL-10 is considered to be an antiinflammatory factor and the release of IL-10 in asthma serves to downregulate the inflammatory reaction associated with this disorder (50–52). IL-10 is produced by CD4+CD25+ regulatory T cells, which have been shown to play a critical role in several models of tolerance (53, 54). Although in our study it is not clear that tolerance was induced by long-term challenge, the increases in IL-10 with repeated challenge could have contributed to the loss of AHR, the reduction in lung BAL fluid eosinophilia, and perhaps the prevention of eosinophil activation. We also considered "tolerance" from the point of view of oral tolerance developing as a result of licking of the pelt over time with repeated exposures. Initial experiments using repeated intranasal challenges did not alter the character of the responses, but simply shifted the kinetics by 1 to 2 wk (data not shown).

    Considerable efforts have been made by several laboratories to develop a murine model of chronic allergic airway inflammation and AHR (55–60) (see Table E1 in the online supplement). The presumption in these studies is that chronic allergic airway inflammation, expressing an eosinophilic signature, is maintained by long-term (repetitive) airway allergen exposure, which leads to structural airway remodeling and, as a result, persistent AHR. Although the experimental designs varied considerably between the studies (i.e., strains of mice, type of allergen, route of sensitization, and duration or number of airway challenges), the endpoint measurements were common and included AHR, airway eosinophilia, and airway tissue remodeling (goblet cell metaplasia, collagen deposition, and thickness of the airway smooth muscle layer). Of significance in evaluating and comparing these studies is the implication of a specific component in the ability to elicit chronic and persistent changes. Thus, the strain of mouse, the specific allergen, the dose and number of allergen challenges, the route of administration, and the intervals between exposures all have been interpreted to explain a successful outcome. There are also considerable differences in what constitutes a persistent change in, for example, lung function or eosinophilic inflammation, where for the most part, all have shown attenuation of both of these responses with increasing allergen exposure, with rare exceptions (60). The demonstration of increased collagen deposition, smooth muscle hypertrophy, or limited airway eosinophilia with increasing allergen exposure, findings we did not observe, is also subject to interpretation. Careful morphometry, avoidance of tangential sections, and exclusion of areas around blood vessels are absolutely necessary to show such chronic changes, especially in the face of normalization of lung function.

    Concern has also been raised that commercial preparations of OVA are contaminated with endotoxin and that endotoxin coadministration with OVA creates a state of tolerance (61). Somewhat to the contrary, endotoxin contamination has also been stated to be necessary for Th2 responses, at least in some strains of mice (62). We have seen little difference in results when using preparations of OVA assayed to be "endotoxin free."

    A number of studies have focused on the functional diversity of DCs in the lung parenchyma and airways (63–66), and the role these cells play in the priming and activation of T lymphocytes (65, 66). The important contribution of DCs in asthma pathogenesis has also been described (16, 17). The role of DCs after chronic or repeated allergen challenge has not been well defined. In the present study, we determined whether alterations in DC function might account for the progressive decreases in AHR and airway inflammation after increasing challenges, while numbers and expression of CD80 and CD86 were significantly decreased after 11 versus 3 challenges. Further, we investigated whether there were changes in DC numbers or phenotype in the peribronchial lymph nodes, and none were detected. It is unclear at present whether the decrease in number and accessory molecule expression of lung mDCs was responsible for the T-cell unresponsiveness to allergen after increased challenges and whether this was linked to the increase in IL-10 seen after 11 challenges. A number of reports suggested that IL-10 attenuates the differentiation and maturation of DCs in vitro, especially mDCs (67–69). Immature mDCs, generated under these high IL-10 conditions, may induce T-cell tolerance (69, 70), thus playing a role in the resolution of AHR and airway allergic inflammation after repeated allergen challenge. de Heer and coworkers reported that pDCs provided intrinsic protection against inflammatory responses to antigen (19). However, in our experiments, pDCs (CD11c+Gr-1+B220+PDCA-1+) were not increased in the lung parenchyma or draining lymph nodes. To directly address the issue of the role of lung mDCs in the resolution of AHR and allergic airway inflammation, transfer experiments were performed. Transfer of antigen-pulsed BMDCs to mice receiving 11 allergen challenges restored responsiveness to allergen, with development of AHR and eosinophilic inflammation. These data suggest that DCs can sustain T-cell–mediated allergic responses in the airways. The mechanism(s) contributing to the restoration of AHR and airway eosinophilia by instillation of mDCs after repeated allergen challenges are not clear. One possibility is that transferred DCs reactivated previously stimulated, antigen-specific T cells. Alternatively, and perhaps more likely, transferred DCs could activate newly primed T cells. BMDCs have the potential to generate primed T cells from naive T cells. Another possibility is that DCs directly cause AHR. Several reports have demonstrated that myeloid DCs have the capacity to produce several cytokines, not only IL-12 and IL-10, but also IL-13, which may directly contribute to airway smooth muscle hypercontractility.

    In summary, this study demonstrates that repeated allergen challenge in two strains of mice results in the loss of AHR to inhaled MCh despite the persistence of airway eosinophilia, at least for a period beyond normalization of lung function. Together with the loss of AHR, there were significant decreases in Th2 cytokine production but consistent and sustained increases in IL-10 and IL-12 levels. Repeated challenge was associated with a reduction in the number of lung mDCs, and transfer of antigen-pulsed DCs reversed this attenuation of AHR and eosinophilic inflammation. This decrease in allergic responsiveness with repeated challenge has plagued the development of a true chronic model of allergen exposure in mice. Nonetheless, the data reveal potential avenues of intervention in preventing some of the long-term consequences of repeated allergen exposure.

    Acknowledgments

    The authors thank Diana Nabighian and Ayako Takahashi for their expert help in preparing the manuscript, and Lynn Cunningham for performing the immunolabeling studies.

    FOOTNOTES

    Supported by NIH grants HL-36577 and HL-61005, and by EPA grant R825702 (to E.W.G.).

    These authors contributed equally to this work.

    This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

    Originally Published in Press as DOI: 10.1164/rccm.200505-783OC on September 28, 2005

    Conflict of Interest Statement: None of the authors have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

    REFERENCES

    Busse WW, Lemanske RF. Asthma. N Engl J Med2001;344:350–362.

    Peebles RS Jr, Hamilton RG, Lichtenstein LM, Schlsoberg M, Liu MC, Proud D, Togias A. Antigen-specific IgE and IgA antibodies in bronchoalveolar lavage fluid are associated with stronger antigen-induced late phase reactions. Clin Exp Allergy2001;31:239–248.

    Bochner BS, Undem BJ, Lichtenstein LM. Immunological aspects of allergic asthma. Annu Rev Immunol1994;12:295–335.

    Kay AB. Asthma and inflammation. J Allergy Clin Immunol1991;87:893–910.

    Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM, Kumar RK, Thomas PS, Seetoo DO, Herbert C, McKenzie AN, et al. Asthma: from bronchoconstriction to airways inflammation and remodeling. Am J Respir Crit Care Med2000;161:1720–1745.

    Ohashi Y, Motpjima S, Fukuda T, Makino S. Airway hyperresponsiveness, increased intracellular spaces of bronchial epithelium, and increased infiltration of eosinophils and lymphocytes in bronchial mucosa in asthma. Am Rev Respir Dis1992;145:1469–1476.

    Benayoun L, Druilhe MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med2003;167:1360–1368.

    Vignola AM, Kips J, Bousquet J. Tissue remodeling as a feature of persistent asthma. J Allergy Clin Immunol2000;105:1041–1053.

    Coutts A, Chen G, Stephens N, Hirest S, Douglas D, Eichholtz T, Khalil N. Release of biologically active TGF- from airway smooth muscle induces autocrine synthesis of collagen. Am J Physiol Lung Cell Mol Physiol2001;280:L999–L1008.

    Wenzel SE, Trudeau JB, Barnes S, Zhou X, Cundall M, Westcott JY, McCord K, Chu W. TGF- and IL-13 synergistically increase eotaxion-1 production in human airway fibrosis. J Immunol2002;169: 4613–4619.

    Robinson DR, Hamid Q, Ying S, Tsicopoulos A, Barkans J, Bentley AM, Corrigan C, Durham SR, Kay AB. Predominant Th2-like bronchoalveolar T-lymphocyte population in atopic asthma. N Engl J Med1992;326:298–304.

    Romagnani S. Cytokines and chemoattractants in allergic inflammation. Mol Immunol2002;38:881–885.

    Kon OM, Kay AB. T cells and chronic asthma. Int Arch Allergy Immunol1991;118:133–135.

    Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K. Immunobiology of dendritic cells. Annu Rev Immunol2000;18:767–811.

    Banchereau J, Paczesny S, Blanco P, Bennett L, Pascual V, Fay J, Palucka AK. Dendritic cells: controllers of the immune system and a new promise for immunotherapy. Ann N Y Acad Sci2003;987:180–187.

    Lambrecht BN, Salomon B, Klatzmann D, Pauwels RA. Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice. J Immunol1998;160:4090–4097.

    van Rijt LS, Jung S, Kleinjan A, Vos N, Willart M, Duez C, Hoogsteden HC, Lambrecht BN. In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. J Exp Med2005;201:981–991.

    Lambrecht BN, De Veerman M, Coyle AJ, Gutierrez-Ramos JC, Thielemans K, Pauwels RA. Myeloid dendritic cells induce Th2 responses to inhaled antigen, leading to eosinophilic airway inflammation. J Clin Invest2000;106:551–559.

    de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med2004;200:89–98.

    Takeda K, Hamelmann E, Joetham A, Shultz LD, Laresn GL, Irvin CG, Gelfand EW. Development of eosinophilic airway inflammation and airway hyperresponsiveness in mast cell-deficient mice. J Exp Med1997;186:449–454.

    Khalil N. TGF-: from latent to active. Microbes Infect1999;1:1255–1263.

    Oshiba A, Hamelmann E, Takeda K, Bradley KL, Loader JE, Larsen GL, Gelfand EW. Passive transfer of immediate hypersensitivity and airway hyperresponsiveness by allergen-specific immunoglobulin (Ig) E and IgG1 in mice. J Clin Invest1996;97:1398–1408.

    Inaba K, Inaba M, Romani N, Aya H, Deguchi M, Ikehara S, Muramatsu S, Steinman RM. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med1992;176:1693–1702.

    Takeda K, Haczku A, Lee JJ, Irvin CG, Gelfand EW. Strain dependence of airway hyperresponsiveness reflects difference in eosinophil localization in the lung. Am J Physiol Lung Cell Mol Physiol2001;281:394–402.

    Whitehead GS, Walker JK, Berman KG, Foster WM, Schwartz DA. Allergen-induced airway disease is mouse strain dependent. Am J Physiol Lung Cell Mol Physiol2003;285:32–42.

    Rha YH, Taube C, Haczku A, Joetham A, Takeda K, Duez C, Siegel M, Aydintug MK, Born WK, Dakhama A, et al. Effect of microbial heat shock proteins on airway inflammation and hyperresponsiveness. J Immunol2002;169:5300–5307.

    Eum SY, Maghni K, Hamid Q, Eidelman DH, Campbell H, Isogai S, Martin JG. Inhibition of allergic airway inflammation and airway hyperresponsiveness in mice by dexamethasone: role of eosinophils, IL-5, eotaxin, and IL-13. J Allergy Clin Immunol2003;111:1049–1061.

    Zimmermann N, Hershey GK, Foster PS, Rothenberg ME. Chemokines in asthma: cooperative interaction between chemokines and IL-13. J Allergy Clin Immunol2003;111:227–242.

    Shi HZ, Xiao CQ, Zhong D, Qin SM, Liu Y, Liang GR, Xu H, Chen YQ, Long XM, Xie ZF. Effect of inhaled interleukin-5 on airway hyperreactivity and eosinophilia in asthmatics. Am J Respir Crit Care Med1998;157:204–209.

    Leckie MJ, ten Brinke A, Khan J, Diamant Z, O'Connor BJ, Walls CM, Mathur AK, Cowley HC, Chung KF, Djukanovic R, et al. Effects of an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyperresponsiveness, and the late asthmatic response. Lancet2000;356: 2144–2148.

    Foster PS, Hogan SP, Ramsay AJ, Matthaei KI, Young IG. Interleukin 5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung damage in a mouse asthma model. J Exp Med1996;186:195–201.

    Mathur M, Herrmann K, Li X, Qin Y, Weinstock J, Elliott D, Monahan J, Padrid P. TRFK-5 reverses established airway eosinophilia but not established hyperresponsiveness in a murine model of chronic asthma. Am J Respir Crit Care Med1999;159:580–587.

    Shen HH, Ochkur SI, McGarru MP, Crosby JR, Hines EM, Borchers MT, Wang H, Biechelle TL, O'Neill KR, Ansay TL, et al. A causative relationship exists between eosinophils and the development of allergic pulmonary pathologies in the mouse. J Immunol2003;170:3296–3305.

    Tomkinson A, Cielewicz G, Duez C, Larson KA, Lee JJ, Gelfand EW. Temporal association between airway hyperresponsiveness and airway eosinophilia in ovalbumin-sensitized mice. Am J Respir Crit Care Med2000;163:721–730.

    Hogan SP, Matthaei KI, Young JM, Koskinen A, Young IG, Foster PS. A novel T cell-regulated mechanism modulating allergen-induced airways hyperresponsiveness in BALB/c mice independently of IL-4 and IL-5. J Immunol1998;161:1501–1509.

    Kanehiro A, Takeda K, Joetham A, Tomkinson A, Ikemura T, Irvin CG, Gelfand EW. Timing of administration of anti-VLA-4 differentiates airway hyperresponsiveness in the central and peripheral airways in mice. Am J Respir Crit Care Med2000;162:1132–1139.

    Kanehiro A, Ikemura T, Makela MJ, Lahn M, Joetham A, Dakhama A, Gelfand EW. Inhibition of phosphodiesterase 4 attenuates airway hyperresponsiveness and airway inflammation in a model of secondary allergen challenge. Am J Respir Crit Care Med2000;163:173–184.

    Lee JJ, Dimina D, Macias MP, Ochkur SI, McGarry MP, O'Neill KR, Protheroe C, Pero R, Nguyen T, Cormier SA, et al. Defining a link with asthma in mice congenitally deficient in eosinophils. Science2004;305:1773–1776.

    Humbles AA, Lloyd CM, McMillan SJ, Friend DS, Xanthou G, McKenna EE, Ghiran S, Gerard NP, Yu C, Orkin SH, et al. A critical role for eosinophils in allergic airways remodeling. Science2004;305:1776–1779.

    Walker C, Kaegi MK, Braun P, Blaser K. Activated T cells and eosinophilia in bronchoalveolar lavages from subjects with asthma correlated with disease severity. J Allergy Clin Immunol1991;88:935–942.

    Gavett SH, Chen X, Finkelman F, Wills-Karp M. Depletion of murine CD4+ T lymphocyte prevents antigen-induced airway hyperreactivity and pulmonary eosinophilia. Am J Respir Cell Mol Biol1994;10:587–593.

    Lee JJ, McGarry MP, Farmer SC, Denzler KL, Larson KA, Carrigan PE, Brenneise IE, Horton MA, Haczku A, Gelfand EW, et al. Interleukin-5 expression in the lung epithelium of transgenic mice leads to pulmonary changes pathognomonic of asthma. J Exp Med1997;185:2143–2156.

    Rankin JA, Picarella DE, Geba GP, Temann UA, Prasad B, DiCosmo B, Tarallo A, Stripp B, Whitsett J, Flavell RA. Phenotypic and physiologic characterization of transgenic mice expressing interleukin 4 in the lung: lymphocytic and eosinophilic inflammation without airway hyperreactivity. Proc Natl Acad Sci USA1996;93:7821–7825.

    Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, Zhang Y, Elias JA. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest1999;103:779–788.

    Akbari O, Freeman GJ, Meyer EH, Greenfield EA, Chang TT, Sharpe AH, Berry G, DeKruyff RH, Umetsu DT. Antigen-specific regulatory T cells develop via the ICOS–ICOS-ligand pathway and inhibit allergen-induced airway hyperreactivity. Nat Med2002;8:1024–1032.

    Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, Romagnani S. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J Exp Med1993;177:1199–1204.

    Chan SH, Perussia B, Gupta JW, Kobayashi M, Pospisil M, Young HA, Wolf SF, Young D, Clark SC, Trinchieri G. Induction of interferon  production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J Exp Med1991;173:869–879.

    Gavett SH, O'Hearn DJ, Li X, Huang SK, Finkelman FD, Wills-Karp M. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice. J Exp Med1995;182:1527–1536.

    Bruselle GG, Kips JC, Peleman RA, Joos GF, Devos RR, Tavernier JH, Pauwels RA. Role of IFN- in the inhibition of the allergic airway inflammation caused by IL-12. Am J Respir Cell Mol Biol1997;17:767–771.

    John M, Lim S, Seybold J, Jose P, Robichaud A, O'Connor B, Barnes PJ, Chung KF. Inhaled corticosteroids increase interleukin-10 but reduce macrophage inflammatory protein-1, granulocyte-macrophage colony-stimulating factor, and interferon- release from alveolar macrophages in asthma. Am J Respir Crit Care Med1998;157:256–262.

    Oh JW, Seroogy CM, Meyer EH, Akbari O, Berry G, Fathman CG, Dekruyff RH, Umetsu DT. CD4 T-helper cells engineered to produce IL-10 prevent allergen-induced airway hyperreactivity and inflammation. J Allergy Clin Immunol2002;110:460–468.

    van Scott MR, Justice JP, Bradfield JF, Enright E, Sigounas A, Sur S. IL-10 reduces Th2 cytokine production and eosinophilia but augments airway reactivity in allergic mice. Am J Physiol Lung Cell Mol Physiol2000;278:L667–L674.

    Kohm AP, Carpentier PA, Anger HA, Miller SD. CD4+CD25+ regulatory T cells suppress antigen-specific autoreactive immune responses and central nervous system inflammation during active experimental autoimmune encephalomyelitis. J Immunol2002;169:4712–4716.

    Salomon B, Lenschow DJ, Rhee L, Ashourian N, Singh B, Sharpe A, Bluestone JA. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity2000;12:431–440.

    Cho JY, Miller M, Baek KJ, Han JW, Nayar J, Rodriguez M, Lee SY, McElwain K, McElwain S, Raz E, et al. Immunostimulatory DNA inhibits transforming growth factor- expression and airway remodeling. Am J Respir Cell Mol Biol2004;30:651–661.

    Johnson JR, Wiley RE, Fattouh R, Swirski FK, Gajewska BU, Coyle AJ, Gutierrez-Ramos JC, Ellis R, Inman MD, Jordana M. Continuous exposure to house dust mite elicits chronic airway inflammation and structural remodeling. Am J Respir Crit Care Med2004;169:378–385.

    Shinagawa K, Kojima M. Mouse model of airway remodeling: strain differences. Am J Respir Crit Care Med2003;168:959–967.

    Temelkovski J, Hogan SP, Shepherd DP, Foster PS, Kumar RK. An improved murine model of asthma: selective airway inflammation, epithelial lesions and increased methacholine responsiveness following chronic exposure to aerosolized allergen. Thorax1998;53:849–856.

    Sakai K, Yokoyama A, Kohno N, Hamada H, Hiwada K. Prolonged antigen exposure ameliorates airway inflammation but not remodeling in a mouse model of bronchial asthma. Int Arch Allergy Immunol2001;126:126–134.

    Leigh R, Ellis R, Wattie J, Southam DS, De Hoogh M, Gauldie J, O'Byrne PM, Inman MD. Dysfunction and remodeling of the mouse airway persist after resolution of acute allergen-induced airway inflammation. Am J Respir Cell Mol Biol2002;27:526–535.

    Gerhold K, Bluemchen K, Franke A, Stock P, Hamelmann E. Exposure to endotoxin and allergen in early life and its effect on allergen sensitization in mice. J Allergy Clin Immunol2003;112:389–396.

    Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K. Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J Exp Med2002;196:1645–1651.

    Stumbles PA, Thomas JA, Pimm CL, Lee PT, Venaille TJ, Proksch S, Holt PG. Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity. J Exp Med1998;188: 2019–2031.

    Constant SL, Brogdon JL, Piggott DA, Herrick CA, Visintin I, Ruddle NH. Resident lung antigen-presenting cells have the capacity to promote Th2 T cell differentiation in situ. J Clin Invest2002;110:1441–1448.

    Julia V, Hessel EM, Malherbe L, Glaichenhaus N, O'Garra A, Coffman RL. A restricted subset of dendritic cells captures airborne antigens and remains able to activate specific T cells long after antigen exposure. Immunity2002;16:271–283.

    Huh JC, Strickland DH, Jahnsen FL, Turner DJ, Thomas JA, Napoli S, Tobagus I, Stumbles PA, Sly PD, Holt PG. Bidirectional interactions between antigen-bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. J Exp Med2003;198:19–30.

    De Smedt T, Van Mechelen M, De Becker G, Urbain J, Leo O, Moser M. Effect of interleukin-10 on dendritic cell maturation and function. Eur J Immunol1997;27:1229–1235.

    Takayama T, Nishioka Y, Lu L, Lotze MT, Tahara H, Thomson AW. Retroviral delivery of viral interleukin-10 into myeloid dendritic cells markedly inhibits their allostimulatory activity and promotes the induction of T-cell hyporesponsiveness. Transplantation1998;66:1567–1574.

    Haase C, Jorgensen TN, Michelsen BK. Both exogenous and endogenous interleukin-10 affects the maturation of bone-marrow-derived dendritic cells in vitro and strongly influences T-cell priming in vivo. Immunology2002;107:489–499.

    Steinbrink K, Wolfl M, Jonuleit H, Knop J, Enk AH. Induction of tolerance by IL-10-treated dendritic cells. J Immunol1997;159:4772–4780.

日期:2007年5月14日 - 来自[2006年第173卷第1期]栏目

Pulmonary Dendritic Cells

    Department of Respiratory Diseases, Ghent University Hospital, Ghent, Belgium

    ABSTRACT

    Dendritic cells (DCs) are leukocytes that are emerging as chief orchestrators of immune responses. The crucial task of DCs is the continuous surveillance of antigen-exposed sites throughout the body, and their unique responsibility is to decide whether to present sampled antigen in an immunogenic or tolerogenic way. Any misstep can either lead to a flawed immune defense or to allergy, even autoimmunity. It comes as no surprise that the lungs become increasingly the subject of DC-related investigations, as they represent a vast interface between the body and the outer world. This constitutes an enormous challenge for the immune system: "firing up" immune responses inappropriately could have devastating results for the fragile gas exchange structures. Evidence accumulates that DCs play a pivotal role in maintaining the delicate balance between tolerance and active immune response in our respiratory system. The exponentially growing body of DC-related publications is a big challenge. This article aims to provide researchers and clinicians with an up-to-date view on DC biology and its relevance to pulmonary medicine. A developing trend in the field of DCs is the shift from fundamental immunologic research toward exciting clinical insights and applications. For the pulmonary clinician, this heralds the dawn of promising therapies in various domains such as infections, allergy, and cancer.

    Key Words: airway; chemokine; chronic obstructive pulmonary disease; dendritic cell; lymph node

    INTRODUCTION

    The "Sentinel" Paradigm of Dendritic Cell Biology

    The first dendritic cells (DCs) were described by Paul Langerhans in 1868 in the basal layers of the epidermis (eer die Nerven der menschlichen Haut. Virchows Archiv fe pathologische Anatomie und Physiologie, und fe klinische Medicin 1868;44:325eC337). These "Langerhans' cells" displayed a typical dendritic morphology, with long, branched arms interdigitating between surrounding epithelial cells. This peculiar shape prompted Dr. Langerhans to consider these cells as a type of neuron. It took more than a century to generate insights through which DCs were correctly identified as white blood cells related to macrophages and monocytes. Subsequently, DCs were described in all lymphoid organs (1), in the blood (2), in the bone marrow (3), and in several other organs, including the lung (4), gut (5), liver (6), heart (7), kidney (8), and urogenital tract (9). Meanwhile, the crucial role of DCs in the control of immunity started to emerge slowly, thanks in part to a series of seminal articles by Steinman and coworkers in the 1970s (1, 10eC13). It was known that T lymphocytes, the effector "muscles" of the immune response, cannot recognize antigens (e.g., microbes, tumor fragments, or allergens) in their native form. So-called antigen-presenting cells (APCs) are required to first sample and then process antigens into short fragments, which are presented to T cells on major histocompatibility complex (MHC) molecules. In addition, APCs provide "costimulatory" molecular signals that are required to raise T-cell activation above a threshold allowing an active response. Before the era of DCs, the only known professional APCs were the macrophages, monocytes, and B lymphocytes. With time, however, it became clear that the antigen-presenting power of DCs greatly exceeded what was documented so far (14, 15). This appeared to rely on some unique features in the biology of these cells (for a comprehensive review, see Reference 16).

    First, DCs are strategically mobilized to anatomic sites with high antigen exposure (e.g., skin, mucosal surfaces, spleen), thanks in part to their sensitivity to a whole array of chemoattracting inflammatory signals. At this stage, DCs are termed "immature," which implies a high capacity to sense, sample, and process incoming antigen, but a poor ability to stimulate T cells. When antigen exposure is accompanied by so-called danger signals (typically, molecular signatures from pathogens or tissue destruction), DCs undergo a series of dramatic changes, which are defined as "maturation" or "activation" (reviewed in Reference 17). From this point on, the antigen-uptake and antigen-processing function is shut down while large amounts of processed antigen are displayed on cell surface MHC molecules, together with a whole battery of T-cell costimulatory factors. At the same time, DCs become specifically attracted to chemokines emanating from the T-celleCrich areas of local lymphoid organs (this is in sharp contrast to more sedentary sentinel cells, such as macrophages). After migration into the lymph node (LN), DCs induce the proliferation of antigen-specific T lymphocytes, which differentiate into cytokine-producing effector T cells capable of recirculating to the endangered tissues. A summary of this "sentinel" paradigm of DC biology and the molecules generally involved is shown in Figure 1.

    Although it constitutes a very efficient defense system, the sentinel function of DCs carries an inherent danger. Invasion by pathogens is usually accompanied by tissue destruction, and there is a substantial risk that activated DCs might take up and present released self-antigens along the way, leading to the induction of autoimmunity. This is especially worrisome because experimental evidence points to the necessity for maintaining self-tolerance throughout life. Fortunately, it appears that DCs play an active role here as well. Indeed, apoptotic cell fragments originating from normal tissue turnover are continuously taken up and processed by DCs (18eC20). Those "resting" DCs that present self-material and home to the T-cell areas in the steady state lead to the priming of immunosuppressive regulatory T cells or even T-cell deletion (21eC24). Understandably, the role of DCs in the protection against, or the induction of, autoimmunity is currently drawing more and more interest.

    In summary, the DC system of leukocytes has evolved into a fine-tuned, highly sensitive sentinel network capable of both igniting as well as shutting down immune responses as appropriate. This article first provides general notions on DC subsets, where these subsets are found in the lung, and how DCs control the pulmonary immune response. In a second part, we summarize current insights on the possible role of DCs in several major pulmonary pathologies.

    Some of the results of the studies described have been previously reported in the form of abstracts (25, 26).

    Defining Features of the Human DC Family

    Despite the arsenal of techniques available to modern-day researchers, DCs are still difficult to study due to a number of issues, as follows, all of which also apply to the lung:

    DCs are rare cells in situ: they represent at most a few percent of the total cell population in a given organ.

    Isolating DCs from tissue samples easily induces activation artifacts: DCs are exquisitely sensitive to stress signals arising from the environment. Classical methods for extraction of these cells involve a whole sequence of procedures, including enzymatic organ digestion, gradient centrifugations, and/or overnight incubation steps. All these interventions can cloud the original state of the DC in situ.

    In contrast to other leukocytes, DCs cannot be immunophenotypically identified using one single antigenic marker. Human DCs are commonly identified by the abundant expression of MHC class II (HLA-DR is commonly used as a marker) and the absence of T, B, and natural killer cell, monocytic, and granulocytic lineage markers. Mature or activated human DCs are characterized by a further increase of HLA-DR and costimulatory molecules (e.g., CD40, B7-1, B7-2) on their surface. Additional specific markers of mature human DCs are the immunoglobulin superfamily member CD83 (27), the 55-kD actin-bundling protein Fascin (28, 29), and the DC-specific lysosome-associated membrane protein DC-LAMP (30).

    An overview of the human DC family tree, together with typical identifying markers, is shown in Figure 2. Currently, an important distinction is made between two main DC subtypes: myeloid DCs (mDCs) and plasmacytoid DCs (pDCs). Human mDCs develop from bone marroweCderived monocytic precursors, whereas pDCs are developmentally related to the lymphoid lineage (31). In addition to differences in identifying markers (32, 33), the most relevant distinction between mDCs and pDCs is functional because these cells are activated by a different set of pathogenic stimuli. This reflects a differential expression of specific Toll-like receptors (TLRs) on both subsets (34).

    TLRs are primitive sensors for "danger signals," which are, for the most part, microbial molecular signatures but also include products released by cell necrosis and extracellular matrix breakdown (reviewed in Reference 35). Human mDCs primarily express TLR2 and TLR4 and become mature in response to LPS and mycobacterial cell wall components. In contrast, human pDCs do not possess LPS-sensing receptors but typically express TLR7 (a target for the immunomodulatory molecule imiquimod) and TLR9 (the receptor for unmethylated microbial DNA sequences). Typically, immature pDCs exposed to viral products secrete massive amounts of type I interferon, indicating that these cells are in fact identical to the long-known natural interferon-producing cell (36). Thus, pDCs first deliver a powerful innate response designed to limit viral replication, after which these cells differentiate into mature DCs capable of triggering an adaptive immune response. In addition to mDCs and pDCs, Langerhans' celleCtype (i.e., intraepithelial) DCs are often considered as a separate DC subset in humans. Their origin and developmental relationship to other DCs is subject to differing views (37eC40). Langerhans' cells (LCs) are typically located above the basement membrane in epithelial layers of antigen-exposed organs and extend long, branched pseudopods between surrounding epithelial cells (41). LCs have specific requirements in terms of hematopoietic growth factors (42), and can be identified by the presence of typical Birbeck granules (tennis racketeCshaped intracellular organelles with unknown function) and a set of markers such as E-cadherin (which anchors LCs to neighboring epithelial cells), CD1a, and Langerin (43). Another subset of DCs are the so-called interstitial-type DCs, first described in the dermis. These share some markers with resident macrophages (e.g., CD68), but in contrast to macrophages, exhibit a potent T-cell stimulatory activity (42). In addition, interstitial DCs appear to be the only DC subset capable of inducing B-cell differentiation and drive humoral immune responses (44).

    DCs OF THE LUNG: LOCALIZATION AND PHENOTYPE

    Sertl and colleagues (4) was one of the first to describe the presence of DCs in the airway epithelium, lung parenchyma, and visceral pleura of human and mouse specimens. These cells displayed a typical dendritic morphology, expressed copious amounts of MHCII on their surface, and acted as potent T-cell stimulators in vitro. Later studies have provided more detail into the features and localization of DCs in the different pulmonary compartments. From a methodologic point of view, immunofluorescent techniques allow identification of pulmonary DCs among low-autofluorescent leukocytes (next to lymphocytes and granulocytes), in contrast to the highly autofluorescent pulmonary macrophages (45eC47). Using this approach, a small number of DCs can be detected in the bronchoalveolar lavage fluid (BALF). A fraction of these cells express LC markers (CD1a, S100) and exhibit potent T-cell stimulatory capabilities in an allogeneic mixed leukocyte reaction (45, 48). A recent study succeeded in distinguishing different DC subsets in human BALF (i.e., an mDC subset; 0.06% of BALF cells) and a pDC subset (0.02%) (49). Within the bronchial epithelium, DCs are found with typical features of LCs, such as the presence of Birbeck granules, the expression of CD1a, and Langerin (Figure 3) (43, 50, 51). Specific tissue preparation techniques applied to rodent specimens have succeeded in visualizing this superficial airway DC network (Figure 4) (52eC54). In the absence of inflammation, DCs are distributed at an average density of several hundred cells per millimeter squared in the large airways, decreasing to less than a hundred DCs per millimeter squared within smaller intrapulmonary airways (52). DCs in the lung parenchyma are present in larger numbers. They are mostly found within interalveolar septa (55). Cochand and coworkers (56) have clearly described the immature character of human lung parenchymal DCs, in terms of low T-cell costimulary molecule expression, the presence of receptors for inflammatory chemokines, and a strong antigen-uptake activity. Recently, our group succeeded in identifying three previously undescribed types of DCs in normal human lung parenchyma: two subsets of mDCs (one, CD11c+/BDCA[blood DC antigen]-1+; the other, CD11c+/BDCA-3+) and one pDC subset (CD11ceC/BDCA-2+) (51). We are currently trying to characterize the functional differences between these subsets, and the impact of lung disease on these cells.

    LUNG DCs AND THE SHAPING OF THE PULMONARY IMMUNE RESPONSE

    A growing body of experimental evidence indicates that the "sentinel" paradigm of DC function applies extremely well to the respiratory system. This implies (1) a constant recruitment of DCs into the lung, (2) a capacity for these cells to sense and capture inhaled antigen, and (3) an efficient transport of processed antigen to the draining pulmonary LNs, where DCs decide which type of immune response will ensue.

    DC Recruitment to the Lung Is Driven by Environmental Stimuli

    Even in the absence of overt inflammation, DCs or their precursors are constantly recruited from the blood into the lung. Holt and coworkers (57) were the first to demonstrate that respiratory tract DCs are continuously replenished by a steady-state bone marrow output. Further studies in animals have shown that the steady-state deployment of the respiratory tract DC network is clearly correlated with age (58): although MHCII+ DCs already colonize the fetal lung mesenchyme, airway mucosal DCs only appear a few days after birth, reaching adultlike density and distribution after weaning. Interestingly, DCs spread in a "wave," which starts at the nasal mucosa and progressively spreads deeper into the trachea, all the way down to the alveolar walls. Also, the degree of maturation or activation seems to correlate with the proximity to the outside environment.

    Not surprisingly, inflammatory stimuli in the inhaled air have a profound impact on these steady-state dynamics. In a series of hallmark experiments, McWilliam and colleagues (59) described how the inhalation of pathogenic material, such as bacteria or viral particles, induced a very rapid influx of DCs into the airways of rats, in some cases peaking already 2 hours after challenge. Remarkably, this DC recruitment was as fast or sometimes ahead of the prototypic neutrophil influx. It was an isolated phenomenon among mononuclear cells because macrophage numbers were not increased and lymphocytes were not present at that time point. This surprising discovery overthrows the classical view of host defense in which a first phase of neutrophilic influx is gradually taken over by a mononuclear infiltrate. It indicates that DC recruitment is an integral part of the early phase of the innate immune response, with the potential to progress toward a powerful adaptive defense.

    Resolution of the inflammation usually restores baseline numbers of pulmonary DCs. However, in some cases, this normalization can be considerably delayed, as observed after Sendai virus infection in rat airways (60), and in a mouse model of respiratory syncytial virus infection in which pulmonary DC numbers were still increased weeks after remission of the acute inflammatory phase (61).

    On a molecular level, isolated respiratory tract DCs were shown to be attracted by a whole array of stimuli, including chemokines, complement cleavage products, and bacterial peptides (62). By far the most studied among these mediators are the chemokines (reviewed in Reference 63). Chemokine concentration gradients elicit a directed cellular movement, a phenomenon known as chemotaxis. In vitro studies show that many cells of the lung produce a wide array of chemokines with a known effect on DCs in general (see Table 1 and References 64eC81), although only a few have been studied in detail with respect to pulmonary DC mobilization. In vivo, different chemokines orchestrate the recruitment of DCs into the lung depending on the inflammatory stimulus present. In a rat model of inhaled heat-killed Moraxella catarrhalis, the phenomenon seemed dependent on the expression of CCR1 and CCR5, which are receptors for the chemokines CCL5 (regulated on activation, normal T-cell expressed and secreted [RANTES]) and/or CCL3 (macrophage inflammatory protein [MIP]-1) produced at the airway level (82). Interestingly, freshly isolated human pulmonary DCs were found to specifically express both CCR1 and CCR5. Meanwhile, chemokines of the monocyte chemotactic protein (MCP) family appear to be important for the recruitment of DCs in a murine model of pulmonary Mycobacterium tuberculosis infection: mice genetically deficient for the corresponding chemokine receptor, CCR2, have a defect in the progressive accumulation of pulmonary DCs after inoculation with M. tuberculosis. This results in a secondary shortage in pulmonary T-cell recruitment, correlating with premature death, compared with wild-type animals (83, 84). In addition to chemokines, the airway epithelium could attract DCs by means of defensins. These are small cationic peptides with bactericidal activity, produced by epithelial cells after contact with pathogenic stimuli (85). Remarkably, human -defensin 2 (which is produced by airway epithelial cells [86]) was shown to engage CCR6, a chemokine receptor typically expressed by immature DCs homing to epithelia (87).

    Finally, nonmicrobial stimuli can also affect the steady-state recruitment of pulmonary DCs. Animals that are housed in specific pathogen-free, yet dusty conditions show an increased influx of DCs into the lung (58). Interestingly, ultrafine particulate matter triggers airway epithelial cells to produce the chemokine CCL20 (MIP-3), a major chemoattractant for CCR6-bearing immature DCs (88). In a model of allergic airway inflammation, CCR6 appears to mediate the recruitment of DCs into the inflamed lung, correlating with a burst of pulmonary CCL20 production a few hours after allergen challenge (89).

    It is not clear yet whether lung DCs are recruited from the blood in a differentiated form or as early precursors. Suda and coworkers (90) have shown that the pulmonary vasculature is enriched with direct DC precursors compared with the peripheral blood circulation. This pool of cells combines a close relationship to the lung tissue environment as well as the potential to differentiate rapidly in strongly immunogenic DCs. Also, the possibility of lung DC population renewal through local proliferation of intrapulmonary progenitors cannot be excluded. It is already known that steady-state pulmonary alveolar macrophage populations are predominantly maintained by in situ cell proliferation, and to a lesser extent by recruitment of monocytic precursors from the circulation (91). Moreover, in the skin, local cell division is the sole mechanism by which LCs appear to regenerate under noninflammatory conditions (92). It is important to note that granulocyte-monocyte colonyeCstimulating factor (GM-CSF), a key growth factor for "DC-poiesis," is expressed in significant amounts in the lung. GM-CSF production in the airways is increased in an inflammatory context (e.g., respiratory viral infection or exposure to environmental pollutants). Wang and colleagues (93) demonstrated how local transgenic overexpression of GM-CSF in the airways can result in a dramatic increase of pulmonary DC numbers. Another important hematopoietic growth factor for DCs is Fms-like tyrosine kinase 3 ligand (Flt-3L) (94). In contrast to GM-CSF, the potential source of Flt-3L within pulmonary tissues has not been mapped. Nevertheless, repeated injection of this cytokine greatly expands DC numbers in the lung parenchyma (95), and conversely, Flt-3LeCdeficient animals have a severe reduction in the number of lung interalveolar DCs, whereas airway mucosal DCs remain unaffected (96). These observations suggest that, similar to DCs in lymphoid organs, lung DCs do not constitute a homogenous population. Rather, lung DCs could fall into separate subsets with possibly different hematopoietic origins.

    In summary, DCs can populate the lung through different mechanisms (Figure 5). DCs present in the blood circulation could be directly recruited by means of appropriate pulmonary chemokine signals. Alternatively, monocytic DC precursors could first be chemoattracted from the blood into the lung and subsequently differentiate into DCs under the influence of cytokines secreted by resident pulmonary cells (e.g., GM-CSF produced by respiratory epithelium). In addition, a hypothetical mechanism for maintaining lung DC homeostasis might be proliferation of putative intrapulmonary DC progenitors, induced by growth factors secreted by resident pulmonary cells (GM-CSF or Flt-3L). Finally, indirect evidence points to the possibility of transdifferentation of pulmonary macrophages into DCs under the influence of GM-CSF (93).

    Lung DCs Continuously Report Antigenic Information from the Airways to Pulmonary LNs

    One of the most crucial specialized functions of DCs is the capture and delivery of antigen to local lymphoid tissues. These are the privileged sites for potential encounters between APCs and antigen-specific lymphocytes (i.e., the basis for mounting an adaptive immune response). The dense superficial network of airway mucosal DCs is ideally positioned for the interception of any potential antigen in the inhaled air. In addition, pulmonary DCs possess the necessary molecular equipment for efficient sensing and sampling of a wide variety of airborne antigens. Receptors of the C-type lectin family are an important family of molecules in this respect (97). These transmembrane sugar-binding proteins act as "pathogen recognition receptors," recognizing carbohydrate motifs present on the surface of several microbial organisms. In addition, they deliver captured antigens to endocytic vesicles for further processing and routing to the MHC class II presentation pathway. Several C-type lectins have been described on pulmonary DCs. Cochand and colleagues (56) revealed a high expression of mannose receptor on lung parenchymal DCs, endowing these cells with a robust endocytic capacity for mannosylated antigen. It is known that several important lung pathogens, such as M. tuberculosis, Pneumocystis carinii, as well as many fungi, display mannose sugars on their surface. DC-SIGN (DC-specific intercellular adhesion molecule [ICAM]-3eCgrabbing nonintegrin), a newly described C-type lectin, appears to be the principal molecule through which M. tuberculosis enters pulmonary DCs (98). DC-SIGN also has affinity for galactomannans present on the cell wall of Aspergillus fumigatus (99). Consequently, binding and internalization of A. fumigatus conidia by DCs correlate with DC-SIGN expression on the surface of these cells. Other lectin-type receptors that have been documented on subsets of lung DCs are Langerin (43, 51), BDCA-2 (51), and, at least in the mouse, DEC-205 (100). However, their function with respect to specific antigen recognition and endocytosis is currently poorly defined. Additional receptors with a role in antigen uptake have been detected on pulmonary DCs: these include IgG-Fc receptors, for the capture of antibodyeCantigen complexes, and C3bi-R (or Mac-1), which binds opsonizing complement fragments (4).

    Using a mouse model, we have shown that antigen uptake by airway DCs can proceed without any breach to the mucosal barrier, and in the absence of any inflammatory stimulus (101). This is surprising given that DCs of mouse intrapulmonary airways are predominantly located underneath the airway epithelial basement membrane, and that these experiments involved administration of large (i.e., nonpermeant) macromolecules in the airways using a rigorously nontraumatic and sterile instillation technique. This could point to an antigen capture mechanism as described in a recent study on the gut mucosa: indeed, despite their subepithelial location, DCs in the intestinal lamina propria are perfectly capable of capturing noninvasive antigens by extending interepithelial pseudopods toward the lumen without disrupting the epithelial barrier's integrity (102).

    The instillation of inert fluorescent macromolecules into the airways enabled us to track DCs migrating and transporting antigen from the airway mucosa toward pulmonary LNs (Figure 6) (101). This transport was rapid, occurred constitutively (i.e., in the absence of inflammation), and the migratory DCs were seen to specifically penetrate the T-cell zones of the mediastinal lymph nodes (MLNs). These observations confirm earlier studies suggesting that the steady-state recruitment of DCs into the lung is balanced by a continuous emigration of these cells to the MLNs (57). Also, intratracheal administration of soluble protein antigen results in the appearance of strong antigen-presenting activity in the draining MLNs, with similar kinetics (103). Analogous conclusions were reached using intratracheal transfer of in vitroeCderived DCs (104, 105), although these cultured DCs might not reflect the exact nature of the endogenous pulmonary DC populations in terms of phenotype, activation level, and antigen-uptake capacity.

    Much research has been devoted to the molecules that help DCs "navigate" toward the T-cell areas of local LNs. Insights into the mechanisms involved might lead to therapeutic strategies in which elicitation of inappropriate immune responses could be averted by blocking antigen transport to LNs. Alternatively, this knowledge could lead to improved vaccine design by optimizing DC homing to LNs. In general, activated DCs use the chemokine receptor CCR7 to guide themselves along chemokine gradients within afferent lymphatic vessels, all the way down to the LN's T-cell areas (106). The CCR7-triggering chemokines expressed in these structures are CCL21 (= SLC [secondary lymphoid organ chemokine]) and CCL19 (= MIP-3) (107, 108). Surprisingly little is known regarding the involvement of this molecular network in the trafficking of lung DCs. In one report, pulmonary CCL21 expression was detected in a peribronchial and perivascular pattern, with virtual absence in the alveolar zones (109). This pattern probably corresponds to the distribution of the deep pulmonary lymphatic vessel plexus and might delineate the migratory route of LN-homing lung DCs. Accordingly, in vivo neutralization of CCL21 could prevent DC homing to pulmonary LNs and the subsequent triggering of a T-celleCdriven immune response (110). In addition to chemokines, lipid metabolites such as leukotrienes and prostaglandins are emerging as important upstream controllers of DC migration toward LNs. It was shown that DCs require the presence of the Cys-leukotriene LTD4 in the immediate extracellular space to be responsive to chemoattraction by CCL19 (111). Prostaglandin E2 (PGE2) produced by epithelial cells after antigen exposure can also stimulate DC emigration toward draining LNs (112, 113). In contrast, PGD2 exerts an opposite effect (114): a recent study showed that PGD2 could inhibit the emigration of airway DCs toward MLNs and consequently prevent the induction of a primary immune response. The same effect was obtained with pharmacologic agonists of the peroxisome proliferator-activated receptor  (PPAR-), an important intracellular mediator of prostaglandin signaling (115, 116).

    As mentioned in the INTRODUCTION, the presence of an inflammatory process at antigen-exposed surfaces is a strong stimulus for the migration of antigen-transporting DCs toward LNs. Transposed to the lung, this would result in an increased flow of antigenic information from the airways toward the MLNs. We have studied this phenomenon in a model of allergic airway disease, and found that ongoing airway inflammation causes a massive and accelerated flux of allergen-transporting DCs from the airway mucosa to the MLNs (117). This is probably due to the intense release of DC-activating inflammatory molecules, such as tumor necrosis factor  (TNF-) and prostaglandins, during allergic airway inflammation. Whether this phenomenon contributes to the amplification of the allergen-driven immune response remains to be investigated.

    DCs Translate Signals from the Pulmonary Environment into a Specific Immune Response

    After arriving into the LNs, DCs face their last and most important task: that is, instruct T cells to respond to presented antigen in the most adequate way. The type and activation state of the DC, the dose of antigen, as well as the nature of concomitant environmental factors present at the time of antigen encounter determine the nature of the resulting T-cell response. Currently, three different possible outcomes for effector T cells are distinguished. A T-helper 1 (Th1) response is characterized by the production of IFN- and TNF by T cells. It is the normal outcome after DC exposure to viruses or bacteria and is crucial for the control of intracellular pathogens such as Mycobacterium spp. It is also the basis of the delayed type hypersensitivity reaction. Th2 differentiation usually occurs after contact with extracellular parasites (e.g., helminths) and involves production of cytokines such as interleukin 4 (IL-4), IL-5, IL-9, and IL-13, resulting in IgE production as well as accumulation of eosinophils and mast cells. Allergens are nonpathogenic environmental antigens that elicit an inappropriate Th2 response. A third main outcome is the induction of tolerogenic or regulatory T cells producing immunosuppressive cytokines, such as IL-10 or transforming growth factor  (TGF-). This is probably the most prevalent response in steady-state conditions. It forms a constant safeguard against the emergence of inappropriate inflammatory reactions to harmless antigen. The way this paradigm can be transposed to the lung's immune homeostasis is summarized in Figure 7.

    It has long been proposed that the airway mucosa is inherently Th2-biased, providing a counterbalance to potentially tissue-damaging Th1 reactions to harmless inhaled antigen. A few studies were aimed at demonstrating the involvement of pulmonary DCs in this phenomenon. Lung DCs were found to produce cytokines such as IL-10 and IL-6, which have often been considered as Th2-skewing (although this remains controversial). In addition, pulmonary DCs showed an impaired ability to produce the Th1-inducing cytokine IL-12 (118, 119). However, a DC-promoted Th2 climate does not necessarily imply protection from inflammation. Lambrecht and colleagues (104) showed that antigen-loaded DCs transferred into the airways of healthy animals migrate to the MLNs and evoke a highly inflammatory Th2-type sensitization. This experiment left open the question concerning the role of the lung's own DCs in the control of the default pulmonary immune response. The latter is more and more regarded as strongly tolerogenic or regulatory by nature, thereby ensuring the protection of the delicate gas exchange structures from excessive inflammation, be it Th1- or Th2-driven. This raises two important questions: (1) Can the induction of tolerance or immunity to inhaled antigen be assigned to specific DC subtypes and (2) What are the molecular mechanisms involved in this process Recently, pDCs in the lung have been described as important actors in the maintenance of tolerance to inhaled antigen (120). This property was attributed to these cells transporting antigen to the thoracic LNs while maintaining low levels of T-cell costimulatory molecules, and high levels of the inhibitory molecule PD-L1. As a result, pulmonary pDCs failed to trigger antigen-specific T-cell proliferation and production of effector cytokines, but induced immunosuppressive T cells instead. Meanwhile, several studies support a concept of duality in pDC function: in baseline conditions, pDCs would exist in a quiescent state with weak immunostimulatory capacity and the ability to induce tolerance, whereas after appropriate stimuli (most notably viral exposure), pDCs would switch to an immunogenic state characterized by an impressive production of type I interferon (121). This paradigm sheds a new light on the recent observation that a totally inert and tolerogenic protein can become immunogenic when coinhaled with a respiratory virus (122).

    Nevertheless, induction of tolerance in the lung is unlikely to be the exclusive function of pDCs. Mice deficient for Flt-3L, a key growth factor for pDCs, show no impairment in the development of tolerance to harmless inhaled antigen. In addition, the mDCs that transport protein antigen to the MLNs produce IL-10 and express high amounts of inducible costimulator ligand (ICOS-L), both of which lead to the induction of antigen-specific regulatory T cells with the power to inhibit airway inflammation (123, 124).

    As expected, the presence of microbial organisms in the lung modifies the outcome of antigen presentation by DCs in the pulmonary LNs. As an example, a single pulmonary delivery of influenza virus leads to a transient amplified flux of DCs toward the MLNs, generating influenza-specific CD8+ T cells that produce large amounts of IFN- (125). Heat-killed Listeria monocytogenes (126) or Aspergillus fumigatus (127) delivered into the airways are also rapidly transported to the MLNs by DCs, leading to the priming of CD4+ T cells. Remarkably, the pulmonary DC is able to discriminate among different fungal components: phagocytosis and processing of Aspergillus conidia induces a Th1 response, whereas uptake of hyphae results in Th2 polarization.

    The immune response initiated by pulmonary DCs is not only preconditioned by stimuli from the inhaled air. The lung's own cells provide numerous molecular signals that are known to affect DC function in some way. Significant insight has been gained regarding the coexistence of pulmonary DCs and macrophages. In the lung parenchyma, macrophages in the alveolar lumen and DCs within interalveolar septa are separated by a fraction of a micrometer. It has repeatedly been reported that alveolar macrophages inhibit DC functions through the production of soluble mediators (128). Alveolar macrophageeCderived nitric oxide was shown to inhibit MHCII expression on lung DCs and suppress their T-cell stimulatory activity (129). Other DC-inhibiting factors secreted by alveolar macrophages include prostaglandins, H2O2, TGF- (130), and IL-10 (131), as well as decoy receptors for IL-1 and TNF (132). Together, these data suggest that pulmonary macrophages exert their well-known immunomodulatory function through an important restraining influence on DCs. In this view, noninvasive aeroantigens could be taken care of by scavenging macrophages crawling over the airway surface, and these cells would produce mediators that prevent the triggering of DC activation. However, damage to the macrophageeCsurfactanteCepithelium barrier would allow antigen to reach deeper sentinel DCs and would shift the local cytokine environment in favor of DC activation and the initiation of an adaptive immune response. Intriguingly, interstitial macrophages can exert a supportive influence on pulmonary DC immune function by preprocessing particulate antigen into smaller peptides that are then loaded on the surface of neighboring DCs (133, 134).

    In contrast to DCeCmacrophage dialogs, the interaction of pulmonary DCs with other prominent cells of the lung has been less studied so far. Nevertheless, airway and alveolar epithelial cells, fibroblasts, mast cells, nerve endings, and lymphocytes all express mediators that are generally known to affect the immunomodulatory function of DCs. The putative interactions of all these pulmonary cell types with DCs (summarized in Figure 8) are a vast and largely unexplored research terrain with important therapeutic implications.

    DCs IN HUMAN LUNG DISEASE: FRIEND OR FOE

    Given the DC's pivotal role in controlling pulmonary immunity, it follows that any aberration in DC function can have a considerable clinical impact. This section reviews the emerging knowledge on the role of DCs in several major lung pathologies.

    Allergic Asthma

    Asthma is a chronic inflammatory disorder of the airways featuring bronchial smooth muscle hyperreactivity, congestion of the airway mucosa, and excessive mucus secretion. This results in characteristic symptoms of wheezing, coughing, and dyspnea. These manifestations are typically variable and the airflow limitation is often reversible. Importantly, there is a relentless increase in asthma incidence throughout the world (www.ginasthma.org).

    The last decades have seen a growing insight in the cellular and molecular mechanisms underlying allergic asthma. Cutting-edge experimental research has progressively shifted the focus from downstream effectors, such as mast cells, IgE, and eosinophils, up to the Th2 lymphocytes and their proallergic cytokine products (e.g., IL-4, IL-5, IL-13) (135). More recent research by our group and others has implicated the DC as an even more upstream instigator in the allergic inflammatory cascade. Introduction of antigen-loaded DCs into the airways of healthy animals is sufficient to induce allergic sensitization to that antigen (104). Conversely, selective elimination of DCs during ongoing allergic airway inflammation results in the virtual disappearance of the inflammatory symptoms (54). Importantly, other APCs in the lung, such as macrophages or B cells, are unable to take over the fundamental role of DCs in the initiation or maintenance of the eosinophilic inflammation (136, 137).

    Experimental studies point to several properties of lung DCs that could account for their crucial role in the maintenance of Th2-based inflammation to inhaled antigen. First, DCs are recruited in massive amounts to the lung during allergic airway inflammation. At the plateau of eosinophilic inflammation, recovery of DCs from BALF is increased 30- to 100-fold (117, 138eC140). This increase is supported by a proliferation of early DC precursors in the bone marrow (140), suggesting possible bone marroweCstimulating signals emanating from the inflamed airways, as was already reported for eosinophils (141). Second, DCs within inflamed airways are unusually activated compared with DCs from healthy lungs: cell surface expression of MHCII and T-cell costimulatory molecules is markedly enhanced, whereas levels of ICOS-L, a molecule involved in the induction of inhalation tolerance (142), are decreased (117). In addition, DCs are the chief producers of the chemokine CCL17 in the lung (139). CCL17 ("TARC" [thymus- and activation-regulated chemokine] in the old nomenclature) is a molecule that specifically attracts Th2 lymphocytes toward APCs (143). The interaction of airway DCs with these allergen-specific T cells leads to reciprocal activation and precedes the appearance of the late-phase asthmatic response (144). Seen as a whole, the local DC activation within the airways, together with the immediate exposure to aeroallergen and the concomitant recruitment of airway T and B cells, could provide an adequate microenvironment for an in situ perpetuation of the chronic airway inflammation. In one report, it was even suggested that the chronicity of allergic airway disease could be attributed to the existence of an exceptionally long-lived subset of allergen-presenting DCs in the BALF (145).

    As would be expected from these data, molecular defects that impair the mobilization of DCs into the lung during allergen exposure should lead to diminished airway inflammation. We and others have identified matrix metalloproteinase 9 (MMP-9) as a critical molecule enabling the entry of DCs into the airways (139, 146). MMP-9 is an MMP that breaks down basement membranes and allows migratory cells to pass from one tissue compartment to another. MMP-9 deficiency impairs DC accumulation after allergen exposure, resulting in a local shortage of CCL17 and ultimately a collapse of the allergic airway inflammation. A summary of experimental insights concerning the role of DCs in the sensitization and maintenance of allergic airway inflammation is provided in Figure 9.

    The relative contribution of mDCs versus pDCs in the pathogenesis of allergic airway disease is a relatively recent subject of debate. Originally, pDCs were termed "DC2," based on a Th2-polarizing character. However, this Th2 effect was probably an artifact of specific in vitro culture conditions (147). It is now clear that, depending on the stimulus, pDCs can initiate Th1- and Th2-biased responses alike (148). It was recently shown that pulmonary pDCs possess some "antiallergic" properties: selective in vivo elimination of pDCs from healthy lungs unleashes severe allergic responses to otherwise tolerogenic inhaled antigen (120). There is additional evidence supporting a potential antiallergic effect of pDC function. It has been shown that administration of CpG oligonucleotides can provide protection from allergic airway inflammation, in a way that is mostly independent of Th1 cytokine production (149). CpG oligodeoxynucleotides are typically known as powerful activators of pDCs, because these cells express the corresponding TLR (TLR9). In vitro studies show that CpG-stimulated pDCs can inhibit Th2 cell proliferation via IFN-/ production (150). These experimental data also suggest that immunomodulatory molecules emerging as antiasthmatic therapies primarily achieve their effect by targeting lung DCs.

    Research on human subjects has provided some important insights on the function of DCs in asthma as well. In patients with asthma, allergen challenge causes a sharp decline in the number of circulating blood mDCs within a few hours (151). During the same timeframe, a rapid accumulation of mDCs occurs within the bronchial mucosa (152). This suggests that, in subjects with asthma, an alteration occurs in the lung's chemokine networks, allowing a rapid entry of blood-borne mDCs into the allergen-exposed lung (pDCs do not seem to be affected in the same way in these studies). Recently, the acute drop in circulating mDCs after allergen challenge was shown to be inhibited by treatment with the cysteinyl leukotriene 1 (CysLT1) receptor antagonist pranlukast (153). This was associated with a decreased production of the DC-attracting chemokine CCL20 (measured in induced sputum), and consistent with the expression of the CysLT1 receptor on circulating mDCs. Earlier studies using bronchial biopsies had already documented an increase in the number of intraepithelial airway DCs in subjects with asthma compared with healthy individuals, and this number returned to control levels after inhaled corticosteroid treatment (it is known from animal studies that glucocorticosteroids induce apoptotic depletion of the airway DC network [53]) (154). A functional comparison between bronchial epithelial DCs isolated from healthy atopic versus atopic donors with asthma yielded interesting results: the respiratory epithelium of subjects with asthma was strongly enriched with CD1a+ DCs, and these cells preferentially induced the production of IL-4 and IL-5 from sensitized autologous Th cells (50). Also, CD1a+ airway mucosal DCs from patients with asthma displayed increased surface levels of FcRI, the high-affinity receptor for IgE, which could help DCs collect IgE-coated allergen on their surface (155).

    Additional studies using human blood as a starting material further confirm that DCs from patients with asthma or allergy are "altered" in a way that secures a perpetuation of the inappropriate Th2 response. The possible role of environmental agents in this phenomenon is the subject of intense research. Diesel exhaust particles have often been proposed as Th2-inducing "adjuvants," and it was recently shown that these pollutants can establish a Th2 milieu by influencing both the DC as well as the responder T cell (156). In addition, diesel exhaust particles cause inflammation at the level of the airways by means of reactive oxygen species (157). This would result in DC activation and thus amplify DC-mediated antigen transport toward MLNs, where antigen would be presented in the context of the Th2-biasing signals. More recently, pollen-derived isoprostanes were shown to activate DCs and turn them into Th2 inducers (158). Additional indoor sources of proallergic factors have also been identifed, such as house dust mites thriving in overinsulated houses or cockroach allergens in inner city areas. Der p-1, a protein found in fecal pellets of the house dust mite Dermatophagoides pteronyssinus, has interesting properties with respect to DC biology. This molecule exhibits proteolytic activity and was shown to cleave epithelial tight junction proteins (159), thereby facilitating the delivery of antigen to intra- or subepithelial DCs. Meanwhile, the disturbance in the epithelial integrity would constitute a danger signal and lead to DC activation. Also, bronchial epithelial cells produce several DC-attracting chemokines after exposure to Der p-1 (160). In several studies, human bloodeCderived DCs were exposed to house dust miteeCderived proteins in vitro. From these investigations, it appears that only DCs obtained from atopic subjects exhibit a proallergic function on exposure to house dust mite protein, whereas DCs from healthy subjects induce no T-cell polarization or even maintain tolerogenic properties (110, 161, 162). Intriguingly, only DCs from atopic individuals secrete high levels of the Th2-attracting chemokines CCL17 and CCL22 after Der p-1 exposure (163). The reason why DCs from atopic individuals are "hard-wired" to preferentially induce and attract proallergic T cells is still obscure. To date there is virtually no evidence for genetic polymorphisms determining the T-celleCpolarizing function of DCs in atopy. Much more research is addressing the question of how environmental influences can help establish an inappropriately Th2-oriented immune climate, sometimes for life. Further exploration of this issue from a DC standpoint might provide a mechanistic basis to the so-called hygiene hypothesis for the increasing prevalence of allergy. This theory proposes that the immune system of infants needs Th1-inducing stimuli (typically provided by microbial exposure) to evolve from an immature, Th2-biased immune response. The more "aseptic" Westernized urban lifestyle, where use of antibiotics and vaccines is widespread and orofecal pathogen burden is low, implies a shortage of such Th1-promoting triggers, thus creating an allergy-prone situation. Alternatively, inappropriate Th2 responses might arise from a failure of tolerogenic mechanisms, rather than from a lack of Th1 stimuli: Wills-Karp and coworkers (164) recently proposed a refinement to the hygiene hypothesis, in which a continuous low level of microbial stimulation (presumably from gut commensals) would ensure a tolerogenic climate dominated by the production of the immunosuppressive cytokine IL-10. Absence of such "counterregulatory" stimulus would thus remove an important inhibition on inappropriate Th2 (allergic) or even Th1 (autoimmune) immune responses.

    There are some interesting elements pointing to the immediate relevance of DCs to the hygiene hypothesis, although many aspects of this complex relationship still need to be resolved. The "immature" character of mucosal immunity in early life might be attributed to the state of the DC system during that period: compared with the adult situation, DCs within neonatal airways are not only less numerous and less mature in terms of MHC expression (58) but also hyporesponsive to inflammatory stimuli (165). In addition, DCs from neonates show an impaired production of IL-12, leading to a defective capacity to induce Th1 responses (166). Holt (167) suggested that a delay in the postnatal acquisition of Th1 competence could explain the difference between atopic and nonatopic individuals. However, in line with the ideas put forth by Wills-Karp and colleagues, we argue that chronic low-level exposure to microbial stimuli would help mucosal DCs evolve toward a tolerogenic rather than a Th1-inducing function in the first place. From that point on, tolerogenic DC networks at mucosal surfaces would constitute the prime sensors for any additional Th1- or Th2-inducing environmental signals, acting alone or in combination. As an experimental illustration of this concept, Eisenbarth and coworkers (168) showed how inert protein antigen coinhaled with low levels of LPS endotoxin triggers airway DCs to induce a Th2 rather than a tolerogenic antigen-specific response. In contrast, coinhalation of high doses of LPS led to a shift from a Th2- to a Th1-biased reaction (168). The modulation of DC-induced airway allergic responses by endotoxin was also confirmed in a report by Kuipers and colleagues (169). These experimental findings are in line with epidemiologic data in which exposure to house dust endotoxin was found to decrease allergic sensitization in infants at high risk of developing asthma (170). In another study, instillation of Dermatophagoides farinae proteineCexposed DCs into the airways of healthy mice led to allergic sensitization to that antigen. However, prior coexposure of the DCs to D. farinae extract together with respiratory syncytial virus shifted the pulmonary immune response in vivo from Th2 toward Th1 (171). It should be noted that this experiment involved exposure of mature DCs to respiratory syncytial virus. Primo-infection with respiratory syncytial virus during early infancy, a time when airway DCs are defective in Th1 polarization, is known to establish a Th2-biased climate in the airways, increasing the risk for the development of asthma in later life.

    Next to environmental stimuli, a number of studies have stressed the importance of tissue-derived factors in the conditioning of DCs toward a proallergic function. PGE2, which can be produced by airway epithelial cells, suppresses IL-12 production by DCs, leading to the development of IL-4eC and IL-5eCproducing T cells (172). Histamine, the prototypic mediator released by mast cells, triggers human DCs to induce Th2 immune responses as well (173), thus creating the possibility of a positive feedback loop involving IgE and activated mast cells (174). This finding sheds new light on the results of a large prospective study, in which intake of an antihistamine during infancy significantly decreased the risk of developing asthma in a subset of allergen-sensitized children (ETAC [Early Treatment of the Atopic Child] study [175]).

    GM-CSF, another product of the airway epithelium, is not only a DC differentiation factor but also a strong Th2-polarizing cytokine in vivo (176). This might explain why in vitroeCgenerated DCs (using an abundance of GM-CSF in the culture medium) induce allergic sensitization after intratracheal transfer, whereas endogenous airway DCs are tolerogenic by default. Thymic stromal lymphopoietin (TSLP), an IL-7eCrelated cytokine produced by epithelial cells and mast cells, is one of the most powerful triggers to date for DC-dependent allergic immune responses in humans (177). TSLP-exposed DCs secrete high amounts of the Th2-attracting chemokines CCL17 (TARC) and prime naive Th cells to produce proallergic cytokines (IL-4, IL-5, IL-13). Although TSLP is expressed in the normal lung and overexpressed in the skin of patients with atopic dermatitis, TSLP levels in asthmatic lungs have not been investigated yet, something that could have important therapeutic implications. Equally important is knowing which environmental factors might trigger an overproduction of TLSP by pulmonary cells.

    In summary, there is compelling evidence to conclude that DCs play a pivotal role in the pathogenesis of allergic asthma. Experimental data indicate that DCs are obligatory APCs for the initiation and maintenance of allergic airway inflammation. In humans, the presence of asthma is associated with an increase in DC numbers in the bronchial mucosa. This increase can be caused by a strikingly rapid movement of circulating DCs into the lung tissue after allergen exposure. Meanwhile, DCs from allergic individuals seem to lose their tolerogenic character and instead perpetuate the allergic state through the expression of costimulatory molecules, cytokines, and chemokines that favor Th2 responses.

    Chronic Obstructive Pulmonary Disease

    In contrast to allergic asthma, the role of DCs in chronic obstructive pulmonary disease (COPD) has been much less investigated. COPD encompasses two clinical entities, each of which correlates with specific histopathologic features. On one hand, there is chronic obstructive bronchiolitis characterized by inflammatory infiltrates surrounding peripheral airways, leading to poorly reversible airflow obstruction (www.goldcopd.com). On the other hand, there is emphysema, which involves a destruction of interalveolar septa with a progressive decrease of the gas exchange surface. The inflammatory infiltrate in COPD contains mainly neutrophils, CD8+ (cytotoxic) T cells, and monocytes/macrophages (reviewed in Reference 178), a combination of cells that has not been fitted into a clear pathogenetic mechanism yet (in contrast to the Th2 lymphocyte/eosinophil presence in asthma).

    Recently, we documented a relentless increase in lung DCs in a murine model of tobacco smokeeCinduced pulmonary emphysema. After 6 months of smoke inhalation, DC numbers in the BALF were 10-fold greater than those observed in control animals (25). An earlier study by Zeid and Muller (179) documented a similar increase in pulmonary Langerhans-like cells on tissue sections of tobacco smokeeCexposed mice. In contrast to these studies, Robbins and coworkers (180) reported a decrease in pulmonary DC numbers after smoke inhalation. The reason for these divergent observations can be attributed in part to the methodology used for the detection of DCs and also to large differences in the smoke exposure regimen (a relatively low dose was used in the latter study).

    In humans, increased numbers of CD1a+ DCs were detected in the airway mucosa of patients with COPD and these numbers declined after fluticasone proprionate inhalation (181). It should be noted that smoking by itself induces an increase in DC numbers in the airways, regardless of the presence of COPD (182, 183). The association of COPD with smoking suggests an innate inflammatory response to inhaled toxic components. It is very likely that the airway DC network is acutely sensitive to smoke inhalation: tobacco smoke contains many potential DC-activating components such as reactive oxygen species and endotoxin. With respect to the latter, we have recently observed a TLR4-dependent activation of pulmonary DCs after smoke inhalation (TLR4 is the signaling receptor for LPS; Maes and colleagues, unpublished manuscript, and Reference 26). In addition, tobacco smoke could trigger airway epithelial cells to release DC-activating factors, such as TNF-, GM-CSF, or heat-shock proteins. It is tempting to speculate that the smoke-activated DCs would lose their default tolerogenic character and induce a sustained immune response to otherwise harmless antigens present in the tobacco smoke (e.g., tobacco glycoprotein). Alternatively, intracellular components released through toxic damage could be chemically altered by smoke and become immunogenic. DCs would then take up, process, and present these modified intracellular antigens to CD8+ cytotoxic T cells. The dangerous combination of activated DCs and an abundance of these "new" antigens could set the stage for a self-perpetuating, tissue-directed immune response with devastating consequences in the long term. This acquired immune response could form the basis for the relentless progression of inflammation observed in patients with severe COPD even after smoking cessation. This disturbing phenomenon was revealed in a study by Retamales and coworkers (184), but was rather attributed to latent adenoviral infection of lung epithelial cells, the degree of which was correlated with emphysema severity and associated with persistent inflammatory cell recruitment despite cessation of smoking. Chronic viral infection could indeed provide a plausible explanation for the relative increase in CD8+ T cells in the airway infiltrates of patients with COPD. Interestingly, smokers with airway obstruction have elevated levels of a specific latent adenoviral DNA sequence compared with smokers without obstructive disease (185). In addition, CD8+ T cells were shown to mediate cytotoxic damage to airway epithelial cells when these were expressing a viral antigen (186). Here again, DCs are known to be required for the initial sensitization of T cells to the viral antigens, either through direct infection of the DCs themselves or after uptake and processing of fragments from infected epithelium (187).

    There are some tantalizing hints suggesting a possible role of DCs in the development of emphysema itself. An indirect indication is that LC histiocytosis (LCH) of the lung, which is also associated with smoking and involves a pathologic accumulation of LCs, is accompanied by destructive lesions in the alveolar zones. On a cellular and molecular level, it has been shown that, during the differentiation from monocytes, DCs show an impressive upregulation of transcripts for human macrophage elastase or MMP-12 (188). MMP-12 appears to be crucial for the induction of emphysematous changes in an animal model of tobacco smoke inhalation (189). In addition, transgenic animals with inducible TNF- have an increase in pulmonary MMP-12 levels and spontaneously develop emphysema (190). TNF- is increased in the sputum of patients with COPD (191) and is a strong activator of DC maturation and trafficking (192, 193). Recently, BALF macrophages from patients with COPD were found to display an increased elastolytic activity in vitro, together with increased expression of MMP-12 mRNA. However, as often in similar studies, BALF cell differentiation is performed on a simple morphologic basis, which precludes any accurate distinction between macrophages and DCs. An interesting observation is that elastin fragments generated through the proteolytic activity of MMP-12 are strongly chemotactic for monocytes (194). An interesting hypothesis would be that the continuous inflammatory transit of DCs through elastin-rich alveolar regions maintains or even amplifies itself by means of chemotactic degradation products. As an indication for such a phenomenon, DC migration into inflamed lung interstitium and BAL compartment is decreased in MMP-12eCdeficient mice (our unpublished observations).

    Further studies in animal models will be necessary to determine whether the pathogenesis of COPD relies in substantial amount on a pathologic response of DCs to tobacco smoke components. These investigations might lead to the discovery of several subentities within COPD, each based on the relative contribution of innate versus adaptive pathologic immune responses in the lung. It is hoped that these insights will help to extend the field of research toward novel targets in COPD treatment.

    Pulmonary LCH

    LCH is a disease characterized by an abnormal accumulation of Langerhans-like cells in one or several organs. Nowadays, the term LCH is used to encompass several clinical entities distinguished on the basis of organ involvement (solitary bone lesions in eosinophilic granuloma, as opposed to systemic involvement in Hand-Sche筶ler-Christian disease, Letterer-Siwe disease, and histiocytosis X). The link between histiocytosis X and Langerhans cells was suggested decades ago by the finding of Birbeck granules in the "histiocytes" accumulating in these lesions (195). The first detailed account of pulmonary involvement was published by Auld (196) in 1957. Classical LC markers, such as CD1a, S-100, and Langerin, are used for the immunohistologic diagnosis of LCH (Figure 10). Langerin has even been suggested as a diagnostic tool for the detection of LCs in the BAL of patients with pulmonary LCH (197). In addition to LCs, LCH granulomas contain macrophages, lymphocytes, and eosinophils (hence the occasional name of "eosinophilic granuloma").

    The disease initially involves granulomatous infiltrations around distal airways. Progression into alveolar zones leads to cystic lesions surrounded by a fibrous reaction. In contrast to the systemic forms of LCH, which typically develop in children, pulmonary LCH is mainly seen in adults and shows a clear association with smoking. Although pulmonary LCH is a rare disease (precise data on prevalence are currently unavailable), a dissection of the pathogenetic mechanisms involved could lead to useful insights on the homeostasis of DCs in the lung in general. There is still much speculation concerning initiating triggers. Tobacco smoke in itself induces an increase in LC numbers in the airway epithelium (182). However, the transition to unbridled accumulation of LCs likely requires additional factors, which could be genetic predisposition, acquired mutations (allelic loss at the level of tumor suppressor genes has been described in LCH lesions [198]), or maybe another environmental trigger, such as viral infection. The accumulation of LCH cells could be due to a local proliferation of putative LC precursors (199, 200), a proliferation that could even be clonal in nature (201). Nevertheless, LCH lacks true features of neoplasia because proliferation rate is very slow (202), lesions are often spontaneously remissive, and LCs are virtually absent from end-stage fibrocystic lesions. Alternatively, LCH lesions could grow through continuous recruitment of new cells. Indeed, the LCs of LCH were shown to express CCR6 as well as its ligand CCL20 (MIP-3) (203): this could imply a paracrine and autocrine mechanism for a self-perpetuating attraction and retention of LCs into the granuloma.

    There is still debate concerning the activation/maturation status of LCs in LCH lesions. In one study, LCH cells were described as having low levels of CD83 and B7-2, and weak T-cell stimulatory capacity (204). Combined with overexpression of CCR6, these findings suggest an immature phenotype, except in self-healing LCH lesions where the LCs appeared mature (204). The immature character of LCH cells seemed to correlate with the presence of numerous IL-10eCsecreting cells in the direct tissue environment. However, these observations were made in bone and skin LCH lesions; similar investigations performed in the lung show that LCs in pulmonary LCH are clearly mature, with very high expression of B7-1 and B7-2 (205). The mature/activated state of pulmonary LCH cells was clearly supported by the local presence of a DC-activating cytokine milieu with elevated IL-1 and low levels of IL-10. A robust increase in GM-CSF production has been documented in LCH lesions (206), whereas increased TNF- has been described in extrapulmonary LCH (207). Notably, both cytokines are known to be critical for the hematopoietic development of LCs (208). A recent study reported elevated levels of Flt-3L and stem cell factor (SCF) in the serum of patients with LCH (209), a combination of hematopoietic growth factors that was shown to sustain long-term expansion of primitive DC precursors (210). In addition, the abundant production of TGF- around LCH lesions (211), combined with GM-CSF, might allow freshly recruited monocytes to differentiate locally into LCs and thus contribute to lesion growth (212).

    It is still unclear why granulomatous LCH lesions at the level of the bronchioles evolve into fibrocystic scars in the alveolar zones. Additional studies on MMP production by LCH cells might shed some light on the process and possibly provide a link with the development of emphysema in smokers. Hayashi and colleagues (213) described overexpression of the collagenolytic MMP-2 in pulmonary LCH cells. Also, the cytokines that are overexpressed in LCH lesions are known to be strong inducers of MMPs in cells of monocytic/dendritic/macrophage lineage (214, 215). The role of non-LCs in LCH lesions is also worth examining. In particular, the interaction between LCH cells and T lymphocytes could be an important factor in the maintenance of the disease. Tazi and coworkers (205) reported a recruitment of CD40L-positive (i.e., activated) T cells around CD40-positive LCH cells, whereas T cells in uninvolved lung tissue were uniformly CD40L-negative. This finding, which was confirmed in pediatric cases of LCH (216), strongly suggest stimulatory, bidirectional interactions between LCH cells and T cells, possibly involving presentation of an as yet unidentified antigen. Tobacco glycoprotein might be a suitable candidate for driving the immune response in smokers with LCH. However, it was shown that lymphocytes from patients with LCH are hyporesponsive when stimulated with tobacco glycoprotein (217). In addition, engagement of CD40 on DCs or LCs leads to activation and cytokine production, even in the absence of cognate interactions (218). Hence, the presence of environmental or perhaps tissue-derived antigens may not be an absolute requirement for maintaining reciprocal LCeCT-cell activations in LCH granulomas. Another aspect of LCH is the frequent recruitment of eosinophils, suggesting some Th2-promoting mechanism. It would be interesting to examine whether TSLP, as a strong DC activator and inducer of Th2 responses, might be involved in the disease. It was recently shown that TSLP synergizes with CD40 engagement on DCs, leading to the induction of IL-5eC and IL-13eCsecreting cytotoxic T cells (219).

    As a whole, LCH remains a complex mix between reactive and neoplastic pathology. Nonetheless, ongoing investigations should continue to borrow knowledge gained in the field of experimental LC biology, in a process that will likely lead to promising therapeutic options for this puzzling disease.

    Lung Cancer

    Cancerous lesions elaborate an arsenal of tricks to evade immune defense: as such, they are perhaps the biggest challenge for the DC system. An insight in the way pulmonary malignancies affect the normal biology of DCs can help determine how best to improve the efficacy of cancer immunotherapy (however, it is by no means the purpose of this article to discuss the proliferation of DC-based cancer vaccines that are currently being developed or even clinically tested). Recent studies show that vascular-endothelial growth factor (VEGF), an important molecule for tumor-induced angiogenesis, is a suppressor of DC development and maturation (220, 221). In histologic analysis of noneCsmall cell lung cancer specimens, VEGF expression and the degree of DC infiltration are inversely related and of prognostic value, with the better prognosis in low-VEGF tumors with abundant DC infiltration (222). In contrast, GM-CSF expression in primary lung carcinoma (noneCsmall cell lung cancer and adenocarcinoma) correlates with increased infiltration of DCs and LCs (223, 224), but the prognostic significance of this finding has not been established. Overexpression of cyclooxygenase 2 (COX-2) by noneCsmall cell lung cancer has been documented as an indicator of poor prognosis (225). In addition, COX-2 and VEGF are both positively correlated in noneCsmall cell lung cancer specimens (226). Interestingly, animal experiments have shown that a whole range of DC functions, including antigen processing, expression of costimulatory molecules, and secretion of IL-12, are suppressed by tumor supernatant in a COX-2eCdependent fashion (227). PGE2, a major product of COX-2, inhibits development of DCs from bone marrow precursors, whereas EP2R knockout animals have longer survival times when inoculated with a lung carcinoma cell line (228). Neuropeptides secreted by small cell lung carcinomas, such as bombesin-like peptides, also interfere with normal DC function through inhibition of maturation and IL-12 production (229).

    An intriguing observation is the preferential infiltration of pDCs, rather than mDCs in noneCsmall cell lung cancer tissue specimens as well as draining lymph nodes (230). This is a finding of potential importance, because CD8+ T cells primed by mDCs display strong cytotoxicity and secrete large amounts of IFN- (232), both important assets for an efficient antitumor response (231). In contrast, CD8+ T cells primed by pDCs become tolerogenic T cells with poor cytolytic responses and elevated secretion of the immunosuppressive IL-10 (232). In addition, human pDCs express indoleamine 2,3-deoxygenase (IDO), an enzyme generating tryptophan catabolites, which are powerful suppressors of T-cell responses. Interestingly, experimental studies described IDO-positive pDCs in tumor-draining LNs, and these cells actively suppressed T-celleCdependent responses to tumor antigens (233). Finally, malignant tissues could disrupt the normal sentinel function of DCs by elaborating aberrant chemokine networks. In fact, several experimental cancer vaccination schemes already aim to improve intratumoral DC infiltration through local induction of DC-attracting chemokines (234, 235).

    Additional molecular mechanisms of lung tumoreCmediated DC suppression will surely be discovered in the future. It is hoped that this knowledge will help to refine DC-based vaccines that can finally "outsmart" the malignant cells and thus have a drastic impact on the poor prognosis of patients with lung cancer.

    Lung Transplant Rejection

    Lung transplantation is a vital therapeutic option in several end-stage lung diseases, such as cystic fibrosis, severe emphysema, idiopathic pulmonary fibrosis, or primary pulmonary hypertension. Unfortunately, compared with other vascularized allografts, lung transplants are prone to a higher incidence of life-threatening chronic rejection, which manifests itself clinically as bronchiolitis obliterans syndrome (affecting more than 10% of post-transplantation survivors per year [236]). Chronic rejection of allografts relies on a T-celleCmediated immune response against donor organ antigens. Increasingly, attention has been drawn to DCs as potential initiators of this reaction. There is a logical place for DCs in the so-called two-way paradigm of donor/acceptor immunologic interactions (237). On one hand, so-called central sensitization to the allograft is initiated in the lymphoid organs of the acceptor. This requires donor APCs emigrating from the donor organ into draining lymphoid tissues of the host. Donor-derived DCs, activated by profuse danger signals originating from the surgical trauma, should be good candidates for this task, provided that severed lymphatic connections have had enough time to reestablish themselves (238). The alternative mechanism for the initiation of rejection involves infiltration of the donor organ by host-derived APCs, a process known as "peripheral" sensitization. In this case, APCs and lymphocytes from the recipient would access the graft via the bronchial circulation and initiate a local T-celleCdriven immune response to donor antigens.

    A few clinical studies have examined the place of DCs in lung transplant rejection, by quantifying the infiltration of these cells in biopsies taken from allografts. Early reports have delivered conflicting results: depending on the methods used, there was either an increase or a decrease in DC numbers reported in the bronchial mucosa of lungs with post-transplantation bronchiolitis obliterans (239, 240). A recent study using more consistent markers (HLA-DR) and superior sampling techniques (endobronchial biopsy) reinforces the notion that DC infiltration is intensified in lung allografts, with chronic rejection as compared with stable transplants (241). Similar findings were made in a rat model, whereby host-derived DCs were seen accumulating in dense peribronchial aggregates for months after transplantation (242). These findings would favor the peripheral mode of allograft sensitization as the predominant process in cell-mediated lung transplant rejection. It should be noted, however, that trafficking of professional APCs to and from allografts is not necessarily detrimental to transplant acceptance. In several types of organ transplantation, including the lung, the establishment of microchimerism (i.e., the seeding of donor-derived leukocytes into acceptor lymphoid and nonlymphoid organs) is correlated with increased graft survival (243, 244). This paradox probably reflects the duality in DC function regarding induction of tolerance versus triggering of an active immune response. It has been proposed that the relatively better outcome of liver as opposed to lung transplants could rely on the hepatic cytokine environment strongly favoring the induction of tolerogenic DCs (245).

    There are several mechanisms through which DCs could induce tolerance. DCs expressing the proapoptotic receptor Fas-L are capable of deleting Fas-expressing T cells in vitro (246). Inspired by these findings, Min and coworkers (247) showed the induction of hyporesponsiveness to a vascularized allograft after injection of donor-derived, FasL-transfected DCs. However, this strategy should be used with great caution. Buonocore and coworkers (248) demonstrated that "FasL-DCs" can exacerbate allogeneic T-cell responses, and even provoke severe pulmonary granulomatous vasculitis after a single systemic injection (249). The reason for these discrepant results is obscure but might be related to differences in the degree of MHC mismatching. An alternative mode of tolerance induction is the generation of hyporeactive or "anergic" T cells by DCs displaying suboptimal levels of costimulatory molecules. Blockade of costimulatory pathways (e.g., using CD40L-blocking antibodies or CTLA-Ig fusion proteins) appears to be a viable strategy in rodent as well as primate transplantation models (250eC252). DCs can also suppress allogeneic T-cell proliferation by means of IDO (see LUNG CANCER). IDO-positive APCs appear to be present within the lung interstitium. Interestingly, overexpression of IDO in lung transplants is capable of abrogating graft rejection in an animal experiment (253). Finally, DCs appear to be involved in the generation of actively immunosuppressive or "regulatory" T cells. Currently, two main categories of regulatory T cells are distinguished (reviewed in Reference 254). On one hand, the inducible "Tr1" and "Th3" cells are immunosuppressive T cells that differentiate under the aegis of nonactivated DCs in the steady state. Tr1 and Th3 cells mediate immunosuppression through the secretion of IL-10 and TGF-, respectively. In turn, these cytokines suppress DC activation, thereby consolidating the tolerogenic climate. It remains to be investigated whether a relationship exists between DC-induced Tr1 or Th3 cell function and lung allograft survival. IL-10 has been shown to efficiently suppress T-cell proliferation and the production of inflammatory cytokines in alloreactions induced by human lung DCs (255). Interestingly, gene transfer of IL-10 is capable of preventing the development of airway fibroobliterating disease in an animal model of tracheal transplantation (256). The other class of immunosuppressive T cells is represented by the CD4+CD25+ "Tregs." These cells, which originate naturally from the thymus, maintain tolerance to self-antigen and also suppress allogeneic immune responses by cell contacteCdependent mechanisms (254). In addition, evidence exists that CD4+CD25+ Tregs need to collaborate with the DC-dependent Tr1 and Th3 cells to achieve optimal immunosuppression in vivo. Interestingly, a recent report showed a negative correlation between CD4+CD25+ cell counts in peripheral blood and the incidence of bronchiolits obliterans more than 3 years after lung transplantation (257). The Treg's high expression of CD25, which is the IL-2R subunit, warrants some caution with respect to using IL-2ReCblocking antibodies as immunosuppressive agents in transplantation medicine (depletion of CD25+ T cells in animals induces fulminant multiorgan autoimmune disease [258]) (259).

    Considering the experimental and clinical data available so far, it appears that DCs could be the key for controlling lung transplant rejection. A thorough knowledge of the anatomy and timing of DC-mediated allograft sensitization is necessary. Subsequently, more refined pharmaceutical interventions could be aimed at preventing activation of DCs in the graft as well as in the recipient, and/or actively support the function of tolerogenic molecules expressed on DCs.

    CONCLUSIONS AND PERSPECTIVES

    Insight into DC biology continues to expand at a furious pace, making it ever harder to define the "state of the art." The road from bench to bedside is particularly challenging when it comes to DC research. Luckily, scientists can nowadays draw from an ever-growing toolbox of techniques, such as gene transfections, RNA silencing, and so forth. However, as in other fields, the challenge will be to promote these cellular manipulations to clinically acceptable strategies. Because of the DC's powerful impact on the outcome of immune responses, any attempt to manipulate these cells for therapeutic purposes must walk the thin line between excessive immune suppression and sparking off autoimmunity. In addition, more fundamental research is needed before reaching the stage of clinical application. As a start, there is still a lot to be investigated in terms of cataloging different DC populations in the lung and documenting their respective function, origin, and relationship to other pulmonary cells. It can be expected that the continuing emergence of new DC markers will create a complex taxonomy that becomes as dendritic as the cells themselves. The next step will be to define with precision which molecular pathways are corrupted as DCs "switch" the normal pulmonary immune response to a pathologic one. Equally important is knowing which external factors divert the normal functions of pulmonary DCs and how genetic polymorphisms modulate the DC's susceptibility. As daunting as these tasks may seem, the reward in the field of pulmonary medicine will more than compensate for the efforts: DCs may hold the key to decisive breakthroughs in fighting asthma, COPD, and lung cancer, undoubtedly some of the world's major health issues in the present and in the foreseeable future.

    Acknowledgments

    The authors thank Prof. Dr. G. Joos, Prof. Dr. G. Brusselle, and Dr. I. Demedts for their critical reading of this manuscript. They also thank Dr. I. Demedts and Dr. S. Saeland for providing the micrographs of Langerin-stained pulmonary histiocytosis specimens and normal human bronchial tissue, respectively. In addition, the authors thank Greet Barbier, Eliane Castrique, Indra De Borle, Philippe De Gryze, Kathleen De Saedeleer, Marie-Rose Mouton, Ann Neessen, and Christelle Snauwaert for their technical contribution to this article.

    This article is dedicated to the memory of Prof. Dr. Romain Pauwels, who passed away January 3, 2005.

    REFERENCES

    Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice: I. Morphology, quantitation, tissue distribution. J Exp Med 1973;137:1142eC1162.

    Van Voorhis WC, Hair LS, Steinman RM, Kaplan G. Human dendritic cells: enrichment and characterization from peripheral blood. J Exp Med 1982;155:1172eC1187.

    Egner W, McKenzie JL, Smith SM, Beard ME, Hart DN. Identification of potent mixed leukocyte reaction-stimulatory cells in human bone marrow: putative differentiation stage of human blood dendritic cells. J Immunol 1993;150:3043eC3053.

    Sertl K, Takemura T, Tschachler E, Ferrans VJ, Kaliner MA, Shevach EM. Dendritic cells with antigen-presenting capability reside in airway epithelium, lung parenchyma, and visceral pleura. J Exp Med 1986;163:436eC451.

    Pavli P, Maxwell L, Van de Pol E, Doe F. Distribution of human colonic dendritic cells and macrophages. Clin Exp Immunol 1996;104:124eC132.

    Prickett TC, McKenzie JL, Hart DN. Characterization of interstitial dendritic cells in human liver. Transplantation 1988;46:754eC761.

    Hart DN, Fabre JW. Demonstration and characterization of Ia-positive dendritic cells in the interstitial connective tissues of rat heart and other tissues, but not brain. J Exp Med 1981;154:347eC361.

    Hart DN, Fuggle SV, Williams KA, Fabre JW, Ting A, Morris PJ. Localization of HLA-ABC and DR antigens in human kidney. Transplantation 1981;31:428eC433.

    Hart DN, Fabre JW. Major histocompatibility complex antigens in rat kidney, ureter, and bladder: localization with monoclonal antibodies and demonstration of Ia-positive dendritic cells. Transplantation 1981;31:318eC325.

    Steinman RM, Lustig DS, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice: 3. Functional properties in vivo. J Exp Med 1974;139:1431eC1445.

    Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice: II. Functional properties in vitro. J Exp Med 1974;139:380eC397.

    Steinman RM, Adams JC, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice: IV. Identification and distribution in mouse spleen. J Exp Med 1975;141:804eC820.

    Steinman RM, Kaplan G, Witmer MD, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice: V. Purification of spleen dendritic cells, new surface markers, and maintenance in vitro. J Exp Med 1979;149:1eC16.

    Masten BJ, Lipscomb MF. Comparison of lung dendritic cells and B cells in stimulating naive antigen-specific T cells. J Immunol 1999;162:1310eC1317.

    Nussenzweig MC, Steinman RM, Gutchinov B, Cohn ZA. Dendritic cells are accessory cells for the development of anti-trinitrophenyl cytotoxic T lymphocytes. J Exp Med 1980;152:1070eC1084.

    Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K. Immunobiology of dendritic cells. Annu Rev Immunol 2000;18:767eC811.

    Gallucci S, Matzinger P. Danger signals: SOS to the immune system. Curr Opin Immunol 2001;13:114eC119.

    Huang FP, Platt N, Wykes M, Major JR, Powell TJ, Jenkins CD, MacPherson GG. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J Exp Med 2000;191:435eC444.

    Iyoda T, Shimoyama S, Liu K, Omatsu Y, Akiyama Y, Maeda Y, Takahara K, Steinman RM, Inaba K. The CD8+ dendritic cell subset selectively endocytoses dying cells in culture and in vivo. J Exp Med 2002;195:1289eC1302.

    Scheinecker C, McHugh R, Shevach EM, Germain RN. Constitutive presentation of a natural tissue autoantigen exclusively by dendritic cells in the draining lymph node. J Exp Med 2002;196:1079eC1090.

    Hawiger D, Inaba K, Dorsett Y, Guo M, Mahnke K, Rivera M, Ravetch JV, Steinman RM, Nussenzweig MC. Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J Exp Med 2001;194:769eC779.

    Mahnke K, Schmitt E, Bonifaz L, Enk AH, Jonuleit H. Immature, but not inactive: the tolerogenic function of immature dendritic cells. Immunol Cell Biol 2002;80:477eC483.

    Mougneau E, Hugues S, Glaichenhaus N. Antigen presentation by dendritic cells in vivo. J Exp Med 2002;196:1013eC1016.

    Liu K, Iyoda T, Saternus M, Kimura Y, Inaba K, Steinman RM. Immune tolerance after delivery of dying cells to dendritic cells in situ. J Exp Med 2002;196:1091eC1097.

    Dhulst AI, Vermaelen KY, Brusselle GG, Joos GF, Pauwels RA. Time course of cigarette smoke-induced pulmonary inflammation in mice. Eur Respir J 2005;26:204eC213.

    Maes T, Vermaelen K, Pauwels R. Cigarette-smoke induced pulmonary recruitment and activation of dendritic cells in mice is Toll-like receptor 4 dependent. Eighth International Symposium on Dendritic Cells, Bruges, Belgium, 2004.

    Zhou LJ, Tedder TF. Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily. J Immunol 1995;154:3821eC3835.

    Mosialos G, Birkenbach M, Ayehunie S, Matsumura F, Pinkus GS, Kieff E, Langhoff E. Circulating human dendritic cells differentially express high levels of a 55-kd actin-bundling protein. Am J Pathol 1996;148:593eC600.

    Ross R, Jonuleit H, Bros M, Ross XL, Yamashiro S, Matsumura F, Enk AH, Knop J, Reske-Kunz AB. Expression of the actin-bundling protein fascin in cultured human dendritic cells correlates with dendritic morphology and cell differentiation. J Invest Dermatol 2000;115:658eC663.

    de Saint-Vis B, Vincent J, Vandenabeele S, Vanbervliet B, Pin JJ, Ait-Yahia S, Patel S, Mattei MG, Banchereau J, Zurawski S, et al. A novel lysosome-associated membrane glycoprotein, DC-LAMP, induced upon DC maturation, is transiently expressed in MHC class II compartment. Immunity 1998;9:325eC336.

    Spits H, Couwenberg F, Bakker AQ, Weijer K, Uittenbogaart CH. Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre-DC)2 but not into pre-DC1: evidence for a lymphoid origin of pre-DC2. J Exp Med 2000;192:1775eC1784.

    Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, Liu YJ. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med 1997;185:1101eC1111.

    Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, Miltenyi S, Buck DW, Schmitz J. BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol 2000;165:6037eC6046.

    Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA, Bazan F, Liu YJ. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J Exp Med 2001;194:863eC869.

    Beg AA. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol 2002;23:509eC512.

    Siegal FP, Kadowaki N, Shodell M, Fitzgerald-Bocarsly PA, Shah K, Ho S, Antonenko S, Liu YJ. The nature of the principal type 1 interferon-producing cells in human blood. Science 1999;284:1835eC1837.

    Anjuere F, del Hoyo GM, Martin P, Ardavin C. Langerhans cells develop from a lymphoid-committed precursor. Blood 2000;96:1633eC1637.

    Hacker C, Kirsch RD, Ju XS, Hieronymus T, Gust TC, Kuhl C, Jorgas T, Kurz SM, Rose-John S, Yokota Y, et al. Transcriptional profiling identifies Id2 function in dendritic cell development. Nat Immunol 2003;4:380eC386.

    Zhang Y, Zhang YY, Ogata M, Chen P, Harada A, Hashimoto S, Matsushima K. Transforming growth factor-beta1 polarizes murine hematopoietic progenitor cells to generate Langerhans cell-like dendritic cells through a monocyte/macrophage differentiation pathway. Blood 1999;93:1208eC1220.

    Katz SI, Tamaki K, Sachs DH. Epidermal Langerhans cells are derived from cells originating in bone marrow. Nature 1979;282:324eC326.

    Rowden G, Lewis MG, Sullivan AK. Ia antigen expression on human epidermal Langerhans cells. Nature 1977;268:247eC248.

    Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, Banchereau J. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF alpha. J Exp Med 1996;184:695eC706.

    Valladeau J, Duvert-Frances V, Pin JJ, Dezutter-Dambuyant C, Vincent C, Massacrier C, Vincent J, Yoneda K, Banchereau J, Caux C, et al. The monoclonal antibody DCGM4 recognizes Langerin, a protein specific of Langerhans cells, and is rapidly internalized from the cell surface. Eur J Immunol 1999;29:2695eC2704.

    Caux C, Massacrier C, Vanbervliet B, Dubois B, Durand I, Cella M, Lanzavecchia A, Banchereau J. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocyte-macrophage colony-stimulating factor plus tumor necrosis factor alpha: II. Functional analysis. Blood 1997;90:1458eC1470.

    van Haarst JM, Hoogsteden HC, de Wit HJ, Verhoeven GT, Havenith CE, Drexhage HA. Dendritic cells and their precursors isolated from human bronchoalveolar lavage: immunocytologic and functional properties. Am J Respir Cell Mol Biol 1994;11:344eC350.

    Havenith CE, Breedijk AJ, van Miert PP, Blijleven N, Calame W, Beelen RH, Hoefsmit EC. Separation of alveolar macrophages and dendritic cells via autofluorescence: phenotypical and functional characterization. J Leukoc Biol 1993;53:504eC510.

    Vermaelen K, Pauwels R. Accurate and simple discrimination of mouse pulmonary dendritic cell and macrophage populations by flow cytometry: methodology and new insights. Cytometry 2004;61A:170.

    van Haarst JM, Verhoeven GT, de Wit HJ, Hoogsteden HC, Debets R, Drexhage HA. CD1a+ and CD1a- accessory cells from human bronchoalveolar lavage differ in allostimulatory potential and cytokine production. Am J Respir Cell Mol Biol 1996;15:752eC759.

    Donnenberg VS, Donnenberg AD. Identification, rare-event detection and analysis of dendritic cell subsets in broncho-alveolar lavage fluid and peripheral blood by flow cytometry. Front Biosci 2003;8:s1175eCs1180.

    Bellini A, Vittori E, Marini M, Ackerman V, Mattoli S. Intraepithelial dendritic cells and selective activation of Th2-like lymphocytes in patients with atopic asthma. Chest 1993;103:997eC1005.

    Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. Am J Respir Cell Mol Biol 2005;32:177eC184.

    Schon-Hegrad MA, Oliver J, McMenamin PG, Holt PG. Studies on the density, distribution, and surface phenotype of intraepithelial class II major histocompatibility complex antigen (Ia)- bearing dendritic cells (DC) in the conducting airways. J Exp Med 1991;173:1345eC1356.

    Brokaw JJ, White GW, Baluk P, Anderson GP, Umemoto EY, McDonald DM. Glucocorticoid-induced apoptosis of dendritic cells in the rat tracheal mucosa. Am J Respir Cell Mol Biol 1998;19:598eC605.

    Lambrecht BN, Salomon B, Klatzmann D, Pauwels RA. Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice. J Immunol 1998;160:4090eC4097.

    Holt PG, Schon-Hegrad MA. Localization of T cells, macrophages and dendritic cells in rat respiratory tract tissue: implications for immune function studies. Immunology 1987;62:349eC356.

    Cochand L, Isler P, Songeon F, Nicod LP. Human lung dendritic cells have an immature phenotype with efficient mannose receptors. Am J Respir Cell Mol Biol 1999;21:547eC554.

    Holt PG, Haining S, Nelson DJ, Sedgwick JD. Origin and steady-state turnover of class II MHC-bearing dendritic cells in the epithelium of the conducting airways. J Immunol 1994;153:256eC261.

    Nelson DJ, McMenamin C, McWilliam AS, Brenan M, Holt PG. Development of the airway intraepithelial dendritic cell network in the rat from class II major histocompatibility (Ia)-negative precursors: differential regulation of Ia expression at different levels of the respiratory tract. J Exp Med 1994;179:203eC212.

    McWilliam AS, Nelson D, Thomas JA, Holt PG. Rapid dendritic cell recruitment is a hallmark of the acute inflammatory response at mucosal surfaces. J Exp Med 1994;179:1331eC1336.

    McWilliam AS, Marsh AM, Holt PG. Inflammatory infiltration of the upper airway epithelium during Sendai virus infection: involvement of epithelial dendritic cells. J Virol 1997;71:226eC236.

    Beyer M, Bartz H, Horner K, Doths S, Koerner-Rettberg C, Schwarze J. Sustained increases in numbers of pulmonary dendritic cells after respiratory syncytial virus infection. J Allergy Clin Immunol 2004;113:127eC133.

    McWilliam AS, Napoli S, Marsh AM, Pemper FL, Nelson DJ, Pimm CL, Stumbles PA, Wells TN, Holt PG. Dendritic cells are recruited into the airway epithelium during the inflammatory response to a broad spectrum of stimuli. J Exp Med 1996;184:2429eC2432.

    Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:217eC242.

    Becker S, Quay J, Koren HS, Haskill JS. Constitutive and stimulated MCP-1, GRO alpha, beta, and gamma expression in human airway epithelium and bronchoalveolar macrophages. Am J Physiol 1994;266:L278eCL286.

    Thorley AJ, Goldstraw P, Young A, Tetley TD. Primary human alveolar type II epithelial cell CCL20 (macrophage inflammatory protein-3)-induced dendritic cell migration. Am J Respir Cell Mol Biol 2005;32:262eC267.

    Abdelaziz MM, Devalia JL, Khair OA, Calderon M, Sapsford RJ, Davies RJ. The effect of conditioned medium from cultured human bronchial epithelial cells on eosinophil and neutrophil chemotaxis and adherence in vitro. Am J Respir Cell Mol Biol 1995;13:728eC737.

    Koyama S, Sato E, Nomura H, Kubo K, Nagai S, Izumi T. Type II pneumocytes release chemoattractant activity for monocytes constitutively. Am J Physiol 1997;272:L830eCL837.

    Koyama S, Sato E, Masubuchi T, Takamizawa A, Nomura H, Kubo K, Nagai S, Izumi T. Human lung fibroblasts release chemokinetic activity for monocytes constitutively. Am J Physiol 1998;275:L223eCL230.

    Godiska R, Chantry D, Raport CJ, Schweickart VL, Trong HL, Gray PW. Monocyte chemotactic protein-4: tissue-specific expression and signaling through CC chemokine receptor-2. J Leukoc Biol 1997;61:353eC360.

    Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J Exp Med 1996;184:1101eC1109.

    Gonzalo JA, Lloyd CM, Peled A, Delaney T, Coyle AJ, Gutierrez-Ramos JC. Critical involvement of the chemotactic axis CXCR4/stromal cell-derived factor-1 alpha in the inflammatory component of allergic airway disease. J Immunol 2000;165:499eC508.

    Vulcano M, Struyf S, Scapini P, Cassatella M, Bernasconi S, Bonecchi R, Calleri A, Penna G, Adorini L, Luini W, et al. Unique regulation of CCL18 production by maturing dendritic cells. J Immunol 2003;170:3843eC3849.

    Hieshima K, Imai T, Baba M, Shoudai K, Ishizuka K, Nakagawa T, Tsuruta J, Takeya M, Sakaki Y, Takatsuki K, et al. A novel human CC chemokine PARC that is most homologous to macrophage-inflammatory protein-1 alpha/LD78 alpha and chemotactic for T lymphocytes, but not for monocytes. J Immunol 1997;159:1140eC1149.

    Schall T. Fractalkine: a strange attractor in the chemokine landscape. Immunol Today 1997;18:147.

    Papadopoulos EJ, Sassetti C, Saeki H, Yamada N, Kawamura T, Fitzhugh DJ, Saraf MA, Schall T, Blauvelt A, Rosen SD, et al. Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol 1999;29:2551eC2559.

    Rothenberg ME, Luster AD, Lilly CM, Drazen JM, Leder P. Constitutive and allergen-induced expression of eotaxin mRNA in the guinea pig lung. J Exp Med 1995;181:1211eC1216.

    Cook EB, Stahl JL, Lilly CM, Haley KJ, Sanchez H, Luster AD, Graziano FM, Rothenberg ME. Epithelial cells are a major cellular source of the chemokine eotaxin in the guinea pig lung. Allergy Asthma Proc 1998;19:15eC22.

    Sabatini F, Silvestri M, Sale R, Scarso L, Defilippi AC, Risso FM, Rossi GA. Fibroblast-eosinophil interaction: modulation of adhesion molecules expression and chemokine release by human fetal lung fibroblasts in response to IL-4 and TNF-alpha. Immunol Lett 2002;84:173eC178.

    Yang Y, Loy J, Ryseck RP, Carrasco D, Bravo R. Antigen-induced eosinophilic lung inflammation develops in mice deficient in chemokine eotaxin. Blood 1998;92:3912eC3923.

    Rollins BJ. Chemokines. Blood 1997;90:909eC928.

    Power CA, Church DJ, Meyer A, Alouani S, Proudfoot AE, Clark-Lewis I, Sozzani S, Mantovani A, Wells TN. Cloning and characterization of a specific receptor for the novel CC chemokine MIP-3alpha from lung dendritic cells. J Exp Med 1997;186:825eC835.

    Stumbles PA, Strickland DH, Pimm CL, Proksch SF, Marsh AM, McWilliam AS, Bosco A, Tobagus I, Thomas JA, Napoli S, et al. Regulation of dendritic cell recruitment into resting and inflamed airway epithelium: use of alternative chemokine receptors as a function of inducing stimulus. J Immunol 2001;167:228eC234.

    Peters W, Cyster JG, Mack M, Schlondorff D, Wolf AJ, Ernst JD, Charo IF. CCR2-dependent trafficking of F4/80dim macrophages and CD11cdim/intermediate dendritic cells is crucial for T cell recruitment to lungs infected with Mycobacterium tuberculosis. J Immunol 2004;172:7647eC7653.

    Peters W, Scott HM, Chambers HF, Flynn JL, Charo IF, Ernst JD. Chemokine receptor 2 serves an early and essential role in resistance to Mycobacterium tuberculosis. Proc Natl Acad Sci USA 2001;98:7958eC7963.

    Cole AM, Waring AJ. The role of defensins in lung biology and therapy. Am J Respir Med 2002;1:249eC259.

    Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S, Schroder JM. Mucoid Pseudomonas aeruginosa, TNF-, and IL-1, but not IL-6, induce human -defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol 2000;22:714eC721.

    Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, Shogan J, Anderson M, Schroder JM, Wang JM, Howard OM, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 1999;286:525eC528.

    Reibman J, Hsu Y, Chen LC, Bleck B, Gordon T. Airway epithelial cells release MIP-3/CCL20 in response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol 2003;28:648eC654.

    Lundy SK, Lira SA, Smit JJ, Cook DN, Berlin AA, Lukacs NW. Attenuation of allergen-induced responses in CCR6eC/eC mice is dependent upon altered pulmonary T lymphocyte activation. J Immunol 2005;174:2054eC2060.

    Suda T, McCarthy K, Vu Q, McCormack J, Schneeberger EE. Dendritic cell precursors are enriched in the vascular compartment of the lung. Am J Respir Cell Mol Biol 1998;19:728eC737.

    Coggle JE, Tarling JD. The proliferation kinetics of pulmonary alveolar macrophages. J Leukoc Biol 1984;35:317eC327.

    Merad M, Manz MG, Karsunky H, Wagers A, Peters W, Charo I, Weissman IL, Cyster JG, Engleman EG. Langerhans cells renew in the skin throughout life under steady-state conditions. Nat Immunol 2002;3:1135eC1141.

    Wang J, Snider DP, Hewlett BR, Lukacs NW, Gauldie J, Liang H, Xing Z. Transgenic expression of granulocyte-macrophage colony-stimulating factor induces the differentiation and activation of a novel dendritic cell population in the lung. Blood 2000;95:2337eC2345.

    Maraskovsky E, Daro E, Roux E, Teepe M, Maliszewski CR, Hoek J, Caron D, Lebsack ME, McKenna HJ. In vivo generation of human dendritic cell subsets by Flt3 ligand. Blood 2000;96:878eC884.

    Masten BJ, Olson GK, Kusewitt DF, Lipscomb MF. Flt3 ligand preferentially increases the number of functionally active myeloid dendritic cells in the lungs of mice. J Immunol 2004;172:4077eC4083.

    Walzer T, Brawand P, Swart D, Tocker J, De Smedt T. No defect in T-cell priming, secondary response, or tolerance induction in response to inhaled antigens in Fms-like tyrosine kinase 3 ligand-deficient mice. J Allergy Clin Immunol 2005;115:192eC199.

    Engering A, Geijtenbeek TB, van Kooyk Y. Immune escape through C-type lectins on dendritic cells. Trends Immunol 2002;23:480eC485.

    Tailleux L, Schwartz O, Herrmann JL, Pivert E, Jackson M, Amara A, Legres L, Dreher D, Nicod LP, Gluckman JC, et al. DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells. J Exp Med 2003;197:121eC127.

    Serrano-Gomez D, Dominguez-Soto A, Ancochea J, Jimenez-Heffernan JA, Leal JA, Corbi AL. Dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin mediates binding and internalization of Aspergillus fumigatus Conidia by dendritic cells and macrophages. J Immunol 2004;173:5635eC5643.

    Pollard AM, Lipscomb MF. Characterization of murine lung dendritic cells: similarities to Langerhans cells and thymic dendritic cells. J Exp Med 1990;172:159eC167.

    Vermaelen KY, Carro-Muino I, Lambrecht BN, Pauwels RA. Specific migratory dendritic cells rapidly transport antigen from the airways to the thoracic lymph nodes. J Exp Med 2001;193:51eC60.

    Rescigno M, Urbano M, Valzasina B, Francolini M, Rotta G, Bonasio R, Granucci F, Kraehenbuhl JP, Ricciardi-Castagnoli P. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat Immunol 2001;2:361eC367.

    Xia W, Pinto CE, Kradin RL. The antigen-presenting activities of Ia+ dendritic cells shift dynamically from lung to lymph node after an airway challenge with soluble antigen. J Exp Med 1995;181:1275eC1283.

    Lambrecht BN, De Veerman M, Coyle AJ, Gutierrez-Ramos JC, Thielemans K, Pauwels RA. Myeloid dendritic cells induce Th2 responses to inhaled antigen, leading to eosinophilic airway inflammation. J Clin Invest 2000;106:551eC559.

    Havenith CE, van Miert PP, Breedijk AJ, Beelen RH, Hoefsmit EC. Migration of dendritic cells into the draining lymph nodes of the lung after intratracheal instillation. Am J Respir Cell Mol Biol 1993;9:484eC488.

    Saeki H, Moore AM, Brown MJ, Hwang ST. Cutting edge: secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) participate in the emigration pathway of mature dendritic cells from the skin to regional lymph nodes. J Immunol 1999;162:2472eC2475.

    Sozzani S, Allavena P, D'Amico G, Luini W, Bianchi G, Kataura M, Imai T, Yoshie O, Bonecchi R, Mantovani A. Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J Immunol 1998;161:1083eC1086.

    Yanagihara S, Komura E, Nagafune J, Watarai H, Yamaguchi Y. EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up-regulated upon maturation. J Immunol 1998;161:3096eC3102.

    Itakura M, Tokuda A, Kimura H, Nagai S, Yoneyama H, Onai N, Ishikawa S, Kuriyama T, Matsushima K. Blockade of secondary lymphoid tissue chemokine exacerbates Propionibacterium acnes-induced acute lung inflammation. J Immunol 2001;166:2071eC2079.

    Hammad H, Lambrecht BN, Pochard P, Gosset P, Marquillies P, Tonnel A-B, Pestel J. Monocyte-derived dendritic cells induce a house dust mite-specific Th2 allergic inflammation in the lung of humanized SCID mice: involvement of CCR7. J Immunol 2002;169:1524eC1534.

    Robbiani DF, Finch RA, Jager D, Muller WA, Sartorelli AC, Randolph GJ. The leukotriene C(4) transporter MRP1 regulates CCL19 (MIP-3beta, ELC)-dependent mobilization of dendritic cells to lymph nodes. Cell 2000;103:757eC768.

    Scandella E, Men Y, Legler DF, Gillessen S, Prikler L, Ludewig B, Groettrup M. CCL19/CCL21-triggered signal transduction and migration of dendritic cells require prostaglandin E2. Blood 2003;103:1595eC1601.

    Kabashima K, Sakata D, Nagamachi M, Miyachi Y, Inaba K, Narumiya S. Prostaglandin E(2)-EP4 signaling initiates skin immune responses by promoting migration and maturation of Langerhans cells. Nat Med 2003;12:12.

    Angeli V, Faveeuw C, Roye O, Fontaine J, Teissier E, Capron A, Wolowczuk I, Capron M, Trottein F. Role of the parasite-derived prostaglandin D2 in the inhibition of epidermal Langerhans cell migration during schistosomiasis infection. J Exp Med 2001;193:1135eC1147.

    Angeli V, Hammad H, Staels B, Capron M, Lambrecht BN, Trottein F. Peroxisome proliferator-activated receptor gamma inhibits the migration of dendritic cells: consequences for the immune response. J Immunol 2003;170:5295eC5301.

    Hammad H, Jan De Heer H, Soullie T, Hoogsteden HC, Trottein F, Lambrecht BN. Prostaglandin d(2) inhibits airway dendritic cell migration and function in steady state conditions by selective activation of the d prostanoid receptor 1. J Immunol 2003;171:3936eC3940.

    Vermaelen K, Pauwels R. Accelerated airway dendritic cell maturation, trafficking, and elimination in a mouse model of asthma. Am J Respir Cell Mol Biol 2003;29:405eC409.

    Stumbles PA, Thomas JA, Pimm CL, Lee PT, Venaille TJ, Proksch S, Holt PG. Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity. J Exp Med 1998;188:2019eC2031.

    Dodge IL, Carr MW, Cernadas M, Brenner MB. IL-6 production by pulmonary dendritic cells impedes Th1 immune responses. J Immunol 2003;170:4457eC4464.

    De Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med 2004;200:89eC98.

    Liu YJ. Uncover the mystery of plasmacytoid dendritic cell precursors or type 1 interferon producing cells by serendipity. Hum Immunol 2002;63:1067eC1071.

    Brimnes MK, Bonifaz L, Steinman RM, Moran TM. Influenza virus-induced dendritic cell maturation is associated with the induction of strong T cell immunity to a coadministered, normally nonimmunogenic protein. J Exp Med 2003;198:133eC144.

    Akbari O, DeKruyff RH, Umetsu DT. Pulmonary dendritic cells producing IL-10 mediate tolerance induced by respiratory exposure to antigen. Nat Immunol 2001;2:725eC731.

    Akbari O, Freeman GJ, Meyer EH, Greenfield EA, Chang TT, Sharpe AH, Berry G, DeKruyff RH, Umetsu DT. Antigen-specific regulatory T cells develop via the ICOS-ICOS-ligand pathway and inhibit allergen-induced airway hyperreactivity. Nat Med 2002;8:1024eC1032.

    Legge KL, Braciale TJ. Accelerated migration of respiratory dendritic cells to the regional lymph nodes is limited to the early phase of pulmonary infection. Immunity 2003;18:265eC277.

    Vu Q, McCarthy KM, McCormack JM, Schneeberger EE. Lung dendritic cells are primed by inhaled particulate antigens, and retain MHC class II/antigenic peptide complexes in hilar lymph nodes for a prolonged period of time. Immunology 2002;105:488eC498.

    Bozza S, Gaziano R, Spreca A, Bacci A, Montagnoli C, di Francesco P, Romani L. Dendritic cells transport conidia and hyphae of Aspergillus fumigatus from the airways to the draining lymph nodes and initiate disparate Th responses to the fungus. J Immunol 2002;168:1362eC1371.

    Holt PG, Degebrodt A, O'Leary C, Krska K, Plozza T. T cell activation by antigen-presenting cells from lung tissue digests: suppression by endogenous macrophages. Clin Exp Immunol 1985;62:586eC593.

    Holt PG, Oliver J, Bilyk N, McMenamin C, McMenamin PG, Kraal G, Thepen T. Downregulation of the antigen presenting cell function(s) of pulmonary dendritic cells in vivo by resident alveolar macrophages. Cell Biol Int 1996;20:111eC120.

    Lipscomb MF, Pollard AM, Yates JL. A role for TGF-beta in the suppression by murine bronchoalveolar cells of lung dendritic cell initiated immune responses. Reg Immunol 1993;5:151eC157.

    Lee PT, Holt PG, McWilliam AS. Ontogeny of rat pulmonary alveolar macrophage function: evidence for a selective deficiency in IL-10 and nitric oxide production by newborn alveolar macrophages. Cytokine 2001;15:53eC57.

    Nicod LP, Galve-De-Rochemonteix B, Dayer JM. Modulation of IL-1 receptor antagonist and TNF-soluble receptors produced by alveolar macrophages and blood monocytes. Ann N Y Acad Sci 1994;725:323eC330.

    Kapsenberg ML, Teunissen MB, Stiekema FE, Keizer HG. Antigen-presenting cell function of dendritic cells and macrophages in proliferative T cell responses to soluble and particulate antigens. Eur J Immunol 1986;16:345eC350.

    Girvan A, Aldwell FE, Buchan GS, Faulkner L, Baird MA. Transfer of macrophage-derived mycobacterial antigens to dendritic cells can induce naive T-cell activation. Scand J Immunol 2003;57:107eC114.

    Busse WW, Lemanske RF Jr. Asthma. N Engl J Med 2001;344:350eC362.

    Korsgren M, Erjefalt JS, Korsgren O, Sundler F, Persson CG. Allergic eosinophil-rich inflammation develops in lungs and airways of B cell-deficient mice. J Exp Med 1997;185:885eC892.

    Lambrecht BN, Peleman RA, Bullock GR, Pauwels RA. Sensitization to inhaled antigen by intratracheal instillation of dendritic cells. Clin Exp Allergy 2000;30:214eC224.

    Lambrecht BN, Carro-Muino I, Vermaelen K, Pauwels RA. Allergen-induced changes in bone-marrow progenitor and airway dendritic cells in sensitized rats. Am J Respir Cell Mol Biol 1999;20:1165eC1174.

    Vermaelen KY, Cataldo D, Tournoy K, Maes T, Dhulst A, Louis R, Foidart JM, Noel A, Pauwels R. Matrix metalloproteinase-9-mediated dendritic cell recruitment into the airways is a critical step in a mouse model of asthma. J Immunol 2003;171:1016eC1022.

    Van Rijt LS, Prins JB, Leenen PJ, Thielemans K, De Vries VC, Hoogsteden HC, Lambrecht BN. Allergen-induced accumulation of airway dendritic cells is supported by an increase in CD31hiLy-6Cneg bone marrow precursors in a mouse model of asthma. Blood 2002;100:3663eC3671.

    Ohkawara Y, Lei XF, Stampfli MR, Marshall JS, Xing Z, Jordana M. Cytokine and eosinophil responses in the lung, peripheral blood, and bone marrow compartments in a murine model of allergen-induced airways inflammation. Am J Respir Cell Mol Biol 1997;16:510eC520.

    Gajewska BU, Tafuri A, Swirski FK, Walker T, Johnson JR, Shea T, Shahinian A, Goncharova S, Mak TW, Stampfli MR, et al. B7RP-1 is not required for the generation of Th2 responses in a model of allergic airway inflammation but is essential for the induction of inhalation tolerance. J Immunol 2005;174:3000eC3005.

    Imai T, Nagira M, Takagi S, Kakizaki M, Nishimura M, Wang J, Gray PW, Matsushima K, Yoshie O. Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. Int Immunol 1999;11:81eC88.

    Huh JC, Strickland DH, Jahnsen FL, Turner DJ, Thomas JA, Napoli S, Tobagus I, Stumbles PA, Sly PD, Holt PG. Bidirectional interactions between antigen-bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. J Exp Med 2003;198:19eC30.

    Julia V, Hessel EM, Malherbe L, Glaichenhaus N, O'Garra A, Coffman RL. A restricted subset of dendritic cells captures airborne antigens and remains able to activate specific T cells long after antigen exposure. Immunity 2002;16:271eC283.

    Ichiyasu H, McCormack JM, McCarthy KM, Dombkowski D, Preffer FI, Schneeberger EE. Mmp-9 deficient dendritic cells have impaired migration through tracheal epithelial tight junctions. Am J Respir Cell Mol Biol 2003;30:761eC770.

    Rissoan MC, Soumelis V, Kadowaki N, Grouard G, Briere F, de Waal Malefyt R, Liu YJ. Reciprocal control of T helper cell and dendritic cell differentiation. Science 1999;283:1183eC1186.

    Boonstra A, Asselin-Paturel C, Gilliet M, Crain C, Trinchieri G, Liu YJ, O'Garra A. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation. J Exp Med 2003;197:101eC109.

    Kline JN, Krieg AM, Waldschmidt TJ, Ballas ZK, Jain V, Businga TR. CpG oligodeoxynucleotides do not require TH1 cytokines to prevent eosinophilic airway inflammation in a murine model of asthma. J Allergy Clin Immunol 1999;104:1258eC1264.

    Farkas L, Kvale EO, Johansen FE, Jahnsen FL, Lund-Johansen F. Plasmacytoid dendritic cells activate allergen-specific TH2 memory cells: modulation by CpG oligodeoxynucleotides. J Allergy Clin Immunol 2004;114:436eC443.

    Upham JW, Denburg JA, O'Byrne PM. Rapid response of circulating myeloid dendritic cells to inhaled allergen in asthmatic subjects. Clin Exp Allergy 2002;32:818eC823.

    Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001;56:823eC826.

    Parameswaran K, Liang H, Fanat A, Watson R, Snider DP, O'Byrne PM. Role for cysteinyl leukotrienes in allergen-induced change in circulating dendritic cell number in asthma. J Allergy Clin Immunol 2004;114(1):73eC79.

    Moller GM, Overbeek SE, Van Helden-Meeuwsen CG, Van Haarst JM, Prens EP, Mulder PG, Postma DS, Hoogsteden HC. Increased numbers of dendritic cells in the bronchial mucosa of atopic asthmatic patients: downregulation by inhaled corticosteroids. Clin Exp Allergy 1996;26:517eC524.

    Tunon-De-Lara JM, Redington AE, Bradding P, Church MK, Hartley JA, Semper AE, Holgate ST. Dendritic cells in normal and asthmatic airways: expression of the alpha subunit of the high affinity immunoglobulin E receptor (Fc epsilon RI -alpha). Clin Exp Allergy 1996;26:648eC655.

    Ohtani T, Nakagawa S, Kurosawa M, Mizuashi M, Ozawa M, Aiba S. Cellular basis of the role of diesel exhaust particles in inducing Th2-dominant response. J Immunol 2005;174:2412eC2419.

    Sagai M, Saito H, Ichinose T, Kodama M, Mori Y. Biological effects of diesel exhaust particles: I. In vitro production of superoxide and in vivo toxicity in mouse. Free Radic Biol Med 1993;14:37eC47.

    Traidl-Hoffmann C, Mariani V, Hochrein H, Karg K, Wagner H, Ring J, Mueller MJ, Jakob T, Behrendt H. Pollen-associated phytoprostanes inhibit dendritic cell interleukin-12 production and augment T helper type 2 cell polarization. J Exp Med 2005;201:627eC636.

    Wan H, Winton HL, Soeller C, Tovey ER, Gruenert DC, Thompson PJ, Stewart GA, Taylor GW, Garrod DR, Cannell MB, et al. Der p 1 facilitates transepithelial allergen delivery by disruption of tight junctions. J Clin Invest 1999;104:123eC133.

    Pichavant M, Charbonnier AS, Taront S, Brichet A, Wallaert B, Pestel J, Tonnel AB, Gosset P. Asthmatic bronchial epithelium activated by the proteolytic allergen Der p 1 increases selective dendritic cell recruitment. J Allergy Clin Immunol 2005;115:771eC778.

    Saeki S, Matsuse H, Kondo Y, Machida I, Kawano T, Tomari S, Obase Y, Fukushima C, Kohno S. Effects of antiasthmatic agents on the functions of peripheral blood monocyte-derived dendritic cells from atopic patients. J Allergy Clin Immunol 2004;114:538eC544.

    Charbonnier AS, Hammad H, Gosset P, Stewart GA, Alkan S, Tonnel AB, Pestel J. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response. J Leukoc Biol 2003;73:91eC99.

    Hammad H, Smits HH, Ratajczak C, Nithiananthan A, Wierenga EA, Stewart GA, Jacquet A, Tonnel AB, Pestel J. Monocyte-derived dendritic cells exposed to Der p 1 allergen enhance the recruitment of Th2 cells: major involvement of the chemokines TARC/CCL17 and MDC/CCL22. Eur Cytokine Netw 2003;14:219eC228.

    Wills-Karp M, Santeliz J, Karp CL. The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat Rev Immunol 2001;1:69eC75.

    Nelson DJ, Holt PG. Defective regional immunity in the respiratory tract of neonates is attributable to hyporesponsiveness of local dendritic cells to activation signals. J Immunol 1995;155:3517eC3524.

    Langrish CL, Buddle JC, Thrasher AJ, Goldblatt D. Neonatal dendritic cells are intrinsically biased against Th-1 immune responses. Clin Exp Immunol 2002;128:118eC123.

    Holt PG. Programming for responsiveness to environmental antigens that trigger allergic respiratory disease in adulthood is initiated during the perinatal period. Environ Health Perspect 1998;106:795eC800.

    Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K. Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J Exp Med 2002;196:1645eC1651.

    Kuipers H, Hijdra D, De Vries VC, Hammad H, Prins JB, Coyle AJ, Hoogsteden HC, Lambrecht BN. Lipopolysaccharide-induced suppression of airway Th2 responses does not require IL-12 production by dendritic cells. J Immunol 2003;171:3645eC3654.

    Gereda JE, Leung DY, Thatayatikom A, Streib JE, Price MR, Klinnert MD, Liu AH. Relation between house-dust endotoxin exposure, type 1 T-cell development, and allergen sensitisation in infants at high risk of asthma. Lancet 2000;355:1680eC1683.

    Kondo Y, Matsuse H, Machida I, Kawano T, Saeki S, Tomari S, Obase Y, Fukushima C, Kohno S. Regulation of mite allergen-pulsed murine dendritic cells by respiratory syncytial virus. Am J Respir Crit Care Med 2004;169:494eC498.

    Kalinski P, Hilkens CM, Snijders A, Snijdewint FG, Kapsenberg ML. Dendritic cells, obtained from peripheral blood precursors in the presence of PGE2, promote Th2 responses. Adv Exp Med Biol 1997;417:363eC367.

    Caron G, Delneste Y, Roelandts E, Duez C, Bonnefoy JY, Pestel J, Jeannin P. Histamine polarizes human dendritic cells into Th2 cell-promoting effector dendritic cells. J Immunol 2001;167:3682eC3686.

    Mazzoni A, Young HA, Spitzer JH, Visintin A, Segal DM. Histamine regulates cytokine production in maturing dendritic cells, resulting in altered T cell polarization. J Clin Invest 2001;108:1865eC1873.

    Allergic factors associated with the development of asthma and the influence of cetirizine in a double-blind, randomised, placebo-controlled trial: first results of ETAC. Early Treatment of the Atopic Child. Pediatr Allergy Immunol 1998;9:116eC124.

    Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei XF, Snider DP, Xing Z, Jordana M. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. J Clin Invest 1998;102:1704eC1714.

    Soumelis V, Reche PA, Kanzler H, Yuan W, Edward G, Homey B, Gilliet M, Ho S, Antonenko S, Lauerma A, et al. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat Immunol 2002;3:673eC680.

    Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM, Rogers RM, Sciurba FC, Coxson HO, et al. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004;350:2645eC2653.

    Zeid NA, Muller HK. Tobacco smoke induced lung granulomas and tumors: association with pulmonary Langerhans cells. Pathology 1995;27:247eC254.

    Robbins CS, Dawe DE, Goncharova SI, Pouladi MA, Drannik AG, Swirski FK, Cox G, Stampfli MR. Cigarette smoke decreases pulmonary dendritic cells and impacts antiviral immune responsiveness. Am J Respir Cell Mol Biol 2004;30:202eC211.

    Hoogsteden HC, Verhoeven GT, Lambrecht BN, Prins JB. Airway inflammation in asthma and chronic obstructive pulmonary disease with special emphasis on the antigen-presenting dendritic cell: influence of treatment with fluticasone propionate. Eur J Immunol 1999;29:3815eC3825. [Published erratum appears in Clin Exp Allergy 2000;30(1):152.]

    Casolaro MA, Bernaudin JF, Saltini C, Ferrans VJ, Crystal RG. Accumulation of Langerhans' cells on the epithelial surface of the lower respiratory tract in normal subjects in association with cigarette smoking. Am Rev Respir Dis 1988;137:406eC411.

    Soler P, Moreau A, Basset F, Hance AJ. Cigarette smoking-induced changes in the number and differentiated state of pulmonary dendritic cells/Langerhans cells. Am Rev Respir Dis 1989;139:1112eC1117.

    Retamales I, Elliott WM, Meshi B, Coxson HO, Pare PD, Sciurba FC, Rogers RM, Hayashi S, Hogg JC. Amplification of inflammation in emphysema and its association with latent adenoviral infection. Am J Respir Crit Care Med 2001;164:469eC473.

    Matsuse T, Hayashi S, Kuwano K, Keunecke H, Jefferies WA, Hogg JC. Latent adenoviral infection in the pathogenesis of chronic airways obstruction. Am Rev Respir Dis 1992;146:177eC184.

    Liu AN, Mohammed AZ, Rice WR, Fiedeldey DT, Liebermann JS, Whitsett JA, Braciale TJ, Enelow RI. Perforin-independent CD8(+) T-cell-mediated cytotoxicity of alveolar epithelial cells is preferentially mediated by tumor necrosis factor-alpha: relative insensitivity to Fas ligand. Am J Respir Cell Mol Biol 1999;20:849eC858.

    Heath WR, Carbone FR. Cross-presentation in viral immunity and self-tolerance. Nat Rev Immunol 2001;1:126eC134.

    Le Naour F, Hohenkirk L, Grolleau A, Misek DE, Lescure P, Geiger JD, Hanash S, Beretta L. Profiling changes in gene expression during differentiation and maturation of monocyte-derived dendritic cells using both oligonucleotide microarrays and proteomics. J Biol Chem 2001;276:17920eC17931.

    Hautamaki RD, Kobayashi DK, Senior RM, Shapiro SD. Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science 1997;277:2002eC2004.

    Vuillemenot BR, Rodriguez JF, Hoyle GW. Lymphoid tissue and emphysema in the lungs of transgenic mice inducibly expressing tumor necrosis factor-alpha. Am J Respir Cell Mol Biol 2004;30:438eC448.

    Keatings VM, Collins PD, Scott DM, Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med 1996;153:530eC534.

    Cumberbatch M, Kimber I. Tumour necrosis factor-alpha is required for accumulation of dendritic cells in draining lymph nodes and for optimal contact sensitization. Immunology 1995;84:31eC35.

    Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994;179:1109eC1118.

    Hunninghake GW, Davidson JM, Rennard S, Szapiel S, Gadek JE, Crystal RG. Elastin fragments attract macrophage precursors to diseased sites in pulmonary emphysema. Science 1981;212:925eC927.

    Nezelof C, Basset F, Rousseau MF. Histiocytosis X histogenetic arguments for a Langerhans cell origin. Biomedicine 1973;18:365eC371.

    Auld D. Pathology of eosinophilic granuloma of the lung. AMA Arch Pathol 1957;63:113eC131.

    Smetana K Jr, Mericka O, Saeland S, Homolka J, Brabec J, Gabius HJ. Diagnostic relevance of Langerin detection in cells from bronchoalveolar lavage of patients with pulmonary Langerhans cell histiocytosis, sarcoidosis and idiopathic pulmonary fibrosis. Virchows Arch 2004;444:171eC174.

    Dacic S, Trusky C, Bakker A, Finkelstein SD, Yousem SA. Genotypic analysis of pulmonary Langerhans cell histiocytosis. Hum Pathol 2003;34:1345eC1349.

    Shamoto M. Mitotic histiocytes and intranuclear Langerhans cell granules in histiocytosis X. Virchows Arch B Cell Pathol 1977;24:87eC90.

    Schouten B, Egeler RM, Leenen PJ, Taminiau AH, Van Den Broek LJ, Hogendoorn PC. Expression of cell cycle-related gene products in langerhans cell histiocytosis. J Pediatr Hematol Oncol 2002;24:727eC732.

    Yu RC, Chu C, Buluwela L, Chu AC. Clonal proliferation of Langerhans cells in Langerhans cell histiocytosis. Lancet 1994;343:767eC768.

    Brabencova E, Tazi A, Lorenzato M, Bonay M, Kambouchner M, Emile JF, Hance AJ, Soler P. Langerhans cells in Langerhans cell granulomatosis are not actively proliferating cells. Am J Pathol 1998;152:1143eC1149.

    Annels NE, Da Costa CE, Prins FA, Willemze A, Hogendoorn PC, Egeler RM. Aberrant chemokine receptor expression and chemokine production by Langerhans cells underlies the pathogenesis of Langerhans cell histiocytosis. J Exp Med 2003;12:12.

    Geissmann F, Lepelletier Y, Fraitag S, Valladeau J, Bodemer C, Debre M, Leborgne M, Saeland S, Brousse N. Differentiation of Langerhans cells in Langerhans cell histiocytosis. Blood 2001;97:1241eC1248.

    Tazi A, Moreau J, Bergeron A, Dominique S, Hance AJ, Soler P. Evidence that Langerhans cells in adult pulmonary Langerhans cell histiocytosis are mature dendritic cells: importance of the cytokine microenvironment. J Immunol 1999;163:3511eC3515.

    Tazi A, Bonay M, Bergeron A, Grandsaigne M, Hance AJ, Soler P. Role of granulocyte-macrophage colony stimulating factor (GM-CSF) in the pathogenesis of adult pulmonary histiocytosis X. Thorax 1996;51:611eC614.

    de Graaf JH, Tamminga RY, Dam-Meiring A, Kamps WA, Timens W. The presence of cytokines in Langerhans' cell histiocytosis. J Pathol 1996;180:400eC406.

    Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature 1992;360:258eC261.

    Rolland A, Guyon L, Gill M, Cai YH, Banchereau J, McClain K, Palucka AK. Increased blood myeloid dendritic cells and dendritic cell-poietins in Langerhans cell histiocytosis. J Immunol 2005;174:3067eC3071.

    Curti A, Fogli M, Ratta M, Tura S, Lemoli RM. Stem cell factor and FLT3-ligand are strictly required to sustain the long-term expansion of primitive CD34+DR-dendritic cell precursors. J Immunol 2001;166:848eC854.

    Asakura S, Colby TV, Limper AH. Tissue localization of transforming growth factor-beta1 in pulmonary eosinophilic granuloma. Am J Respir Crit Care Med 1996;154:1525eC1530.

    Geissmann F, Prost C, Monnet JP, Dy M, Brousse N, Hermine O. Transforming growth factor beta1, in the presence of granulocyte/macrophage colony-stimulating factor and interleukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells. J Exp Med 1998;187:961eC966.

    Hayashi T, Rush WL, Travis WD, Liotta LA, Stetler-Stevenson WG, Ferrans VJ. Immunohistochemical study of matrix metalloproteinases and their tissue inhibitors in pulmonary Langerhans' cell granulomatosis. Arch Pathol Lab Med 1997;121:930eC937.

    Noirey N, Staquet MJ, Gariazzo MJ, Serres M, Andre C, Schmitt D, Vincent C. Relationship between expression of matrix metalloproteinases and migration of epidermal and in vitro generated Langerhans cells. Eur J Cell Biol 2002;81:383eC389.

    Mautino G, Henriquet C, Gougat C, Le Cam A, Dayer JM, Bousquet J, Capony F. Increased expression of tissue inhibitor of metalloproteinase-1 and loss of correlation with matrix metalloproteinase-9 by macrophages in asthma. Lab Invest 1999;79:39eC47.

    Egeler RM, Favara BE, Laman JD, Claassen E. Abundant expression of CD40 and CD40-ligand (CD154) in paediatric Langerhans cell histiocytosis lesions. Eur J Cancer 2000;36:2105eC2110.

    Youkeles LH, Grizzanti JN, Liao Z, Chang CJ, Rosenstreich DL. Decreased tobacco-glycoprotein-induced lymphocyte proliferation in vitro in pulmonary eosinophilic granuloma. Am J Respir Crit Care Med 1995;151:145eC150.

    O'Sullivan BJ, Thomas R. CD40 ligation conditions dendritic cell antigen-presenting function through sustained activation of NF-kappaB. J Immunol 2002;168:5491eC5498.

    Gilliet M, Soumelis V, Watanabe N, Hanabuchi S, Antonenko S, De Waal-Malefyt R, Liu YJ. Human dendritic cells activated by TSLP and CD40L induce proallergic cytotoxic T cells. J Exp Med 2003;197:1059eC1063.

    Gabrilovich DI, Chen HL, Girgis KR, Cunningham HT, Meny GM, Nadaf S, Kavanaugh D, Carbone DP. Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. Nat Med 1996;2:1096eC1103.

    Oyama T, Ran S, Ishida T, Nadaf S, Kerr L, Carbone DP, Gabrilovich DI. Vascular endothelial growth factor affects dendritic cell maturation through the inhibition of nuclear factor-kappa B activation in hemopoietic progenitor cells. J Immunol 1998;160:1224eC1232.

    Inoshima N, Nakanishi Y, Minami T, Izumi M, Takayama K, Yoshino I, Hara N. The influence of dendritic cell infiltration and vascular endothelial growth factor expression on the prognosis of non-small cell lung cancer. Clin Cancer Res 2002;8:3480eC3486.

    Colasante A, Castrilli G, Aiello FB, Brunetti M, Musiani P. Role of cytokines in distribution and differentiation of dendritic cell/Langerhans' cell lineage in human primary carcinomas of the lung. Hum Pathol 1995;26:866eC872.

    Tazi A, Bouchonnet F, Grandsaigne M, Boumsell L, Hance AJ, Soler P. Evidence that granulocyte macrophage-colony-stimulating factor regulates the distribution and differentiated state of dendritic cells/Langerhans cells in human lung and lung cancers. J Clin Invest 1993;91:566eC576.

    Khuri FR, Wu H, Lee JJ, Kemp BL, Lotan R, Lippman SM, Feng L, Hong WK, Xu XC. Cyclooxygenase-2 overexpression is a marker of poor prognosis in stage I non-small cell lung cancer. Clin Cancer Res 2001;7:861eC867.

    Marrogi AJ, Travis WD, Welsh JA, Khan MA, Rahim H, Tazelaar H, Pairolero P, Trastek V, Jett J, Caporaso NE, et al. Nitric oxide synthase, cyclooxygenase 2, and vascular endothelial growth factor in the angiogenesis of non-small cell lung carcinoma. Clin Cancer Res 2000;6:4739eC4744.

    Sharma S, Stolina M, Yang SC, Baratelli F, Lin JF, Atianzar K, Luo J, Zhu L, Lin Y, Huang M, et al. Tumor cyclooxygenase 2-dependent suppression of dendritic cell function. Clin Cancer Res 2003;9:961eC968.

    Yang L, Yamagata N, Yadav R, Brandon S, Courtney RL, Morrow JD, Shyr Y, Boothby M, Joyce S, Carbone DP, et al. Cancer-associated immunodeficiency and dendritic cell abnormalities mediated by the prostaglandin EP2 receptor. J Clin Invest 2003;111:727eC735.

    Makarenkova VP, Shurin GV, Tourkova IL, Balkir L, Pirtskhalaishvili G, Perez L, Gerein V, Siegfried JM, Shurin MR. Lung cancer-derived bombesin-like peptides down-regulate the generation and function of human dendritic cells. J Neuroimmunol 2003;145:55eC67.

    Tabarkiewicz J, Wojas K, Rolinski J. BDCA-1 positive cells and BDCA-2 positive cells in peripheral blood, metastatic lymph nodes and cancer tissue in patients with noneCsmall cell lung cancer. Seventh International Symposium on Dendritic Cells; 2002; Bamberg, Germany.

    Weynants P, Wauters P, Coulie PG, Van den Eynde B, Symann M, Boon T. Cytolytic response of human T cells against allogeneic small cell lung carcinoma treated with interferon gamma. Cancer Immunol Immunother 1988;27:228eC232.

    Gilliet M, Liu YJ. Generation of human CD8 T regulatory cells by CD40 ligand-activated plasmacytoid dendritic cells. J Exp Med 2002;195:695eC704.

    Munn DH, Sharma MD, Hou D, Baban B, Lee JR, Antonia SJ, Messina JL, Chandler P, Koni PA, Mellor AL. Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. J Clin Invest 2004;114:280eC290.

    Vicari AP, Vanbervliet B, Massacrier C, Chiodoni C, Vaure C, Ait-Yahia S, Dercamp C, Matsos F, Reynard O, Taverne C, et al. In vivo manipulation of dendritic cell migration and activation to elicit antitumour immunity. Novartis Found Symp 2004;256:241eC254. [Discussion: 254eC629.]

    Hillinger S, Yang SC, Zhu L, Huang M, Duckett R, Atianzar K, Batra RK, Strieter RM, Dubinett SM, Sharma S. EBV-induced molecule 1 ligand chemokine (ELC/CCL19) promotes IFN-gamma-dependent antitumor responses in a lung cancer model. J Immunol 2003;171:6457eC6465.

    Trulock EP, Edwards LB, Taylor DO, Boucek MM, Mohacsi PJ, Keck BM, Hertz MI. The registry of the International Society for Heart and Lung Transplantation: twentieth official adult lung and heart-lung transplant report—2003. J Heart Lung Transplant 2003;22:625eC635.

    Starzl TE, Murase N, Thomson A, Demetris AJ, Qian S, Rao AS, Fung JJ. The bidirectional paradigm of transplant immunology. Ann N Y Acad Sci 1995;770:165eC176.

    Ruggiero R, Muz J, Fietsam R Jr, Thomas GA, Welsh RJ, Miller JE, Stephenson LW, Baciewicz FA Jr. Reestablishment of lymphatic drainage after canine lung transplantation. J Thorac Cardiovasc Surg 1993;106:167eC171.

    Milne DS, Gascoigne AD, Coaker J, Sviland L, Ashcroft T, Malcolm AJ, Corris PA. Mononuclear phagocyte populations in the transplanted human lung. Transplantation 1998;66:671eC673.

    Yousem SA, Ray L, Paradis IL, Dauber JA, Griffith BP. Potential role of dendritic cells in bronchiolitis obliterans in heart-lung transplantation. Ann Thorac Surg 1990;49:424eC428.

    Leonard CT, Soccal PM, Singer L, Berry GJ, Theodore J, Holt PG, Doyle RL, Rosen GD. Dendritic cells and macrophages in lung allografts: a role in chronic rejection Am J Respir Crit Care Med 2000;161:1349eC1354.

    Uyama T, Winter JB, Sakiyama S, Monden Y, Groen G, Prop J. Replacement of dendritic cells in the airways of rat lung allografts. Am Rev Respir Dis 1993;148:760eC767.

    Reinsmoen NL, Jackson A, McSherry C, Ninova D, Wiesner RH, Kondo M, Krom RA, Hertz MI, Bolman RM III, Matas AJ. Organ-specific patterns of donor antigen-specific hyporeactivity and peripheral blood allogeneic microchimerism in lung, kidney, and liver transplant recipients. Transplantation 1995;60:1546eC1554.

    McSherry C, Jackson A, Hertz MI, Bolman RM III, Savik K, Reinsmoen NL. Sequential measurement of peripheral blood allogeneic microchimerism levels and association with pulmonary function. Transplantation 1996;62:1811eC1818.

    Thomson AW, Lu L. Are dendritic cells the key to liver transplant tolerance Immunol Today 1999;20:27eC32.

    Suss G, Shortman K. A subclass of dendritic cells kills CD4 T cells via Fas/Fas-ligand- induced apoptosis. J Exp Med 1996;183:1789eC1796.

    Min WP, Gorczynski R, Huang XY, Kushida M, Kim P, Obataki M, Lei J, Suri RM, Cattral MS. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. J Immunol 2000;164:161eC167.

    Buonocore S, Paulart F, Le Moine A, Braun M, Salmon I, Van Meirvenne S, Thielemans K, Goldman M, Flamand V. Dendritic cells overexpressing CD95 (Fas) ligand elicit vigorous allospecific T-cell responses in vivo. Blood 2003;101:1469eC1476.

    Buonocore S, Flamand V, Claessen N, Heeringa P, Goldman M, Florquin S. Dendritic cells overexpressing Fas-ligand induce pulmonary vasculitis in mice. Clin Exp Immunol 2004;137:74eC80.

    Kirk AD, Harlan DM, Armstrong NN, Davis TA, Dong Y, Gray GS, Hong X, Thomas D, Fechner JH Jr, Knechtle SJ. CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc Natl Acad Sci USA 1997;94:8789eC8794.

    Larsen CP, Elwood ET, Alexander DZ, Ritchie SC, Hendrix R, Tucker-Burden C, Cho HR, Aruffo A, Hollenbaugh D, Linsley PS, et al. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature 1996;381:434eC438.

    Rifle G, Mousson C. Dendritic cells and second signal blockade: a step toward allograft tolerance Transplantation 2002;73:S1eCS2.

    Swanson KA, Zheng Y, Heidler KM, Mizobuchi T, Wilkes DS. CD11c+ cells modulate pulmonary immune responses by production of indoleamine 2,3-dioxygenase. Am J Respir Cell Mol Biol 2004;30:311eC318.

    Jonuleit H, Schmitt E. The regulatory T cell family: distinct subsets and their interrelations. J Immunol 2003;171:6323eC6327.

    Nicod LP, el Habre F, Dayer JM, Boehringer N. Interleukin-10 decreases tumor necrosis factor alpha and beta in alloreactions induced by human lung dendritic cells and macrophages. Am J Respir Cell Mol Biol 1995;13:83eC90.

    Boehler A, Chamberlain D, Xing Z, Slutsky AS, Jordana M, Gauldie J, Liu M, Keshavjee S. Adenovirus-mediated interleukin-10 gene transfer inhibits post-transplant fibrous airway obliteration in an animal model of bronchiolitis obliterans. Hum Gene Ther 1998;9:541eC551.

    Meloni F, Vitulo P, Bianco AM, Paschetto E, Morosini M, Cascina A, Mazzucchelli I, Ciardelli L, Oggionni T, Fietta AM, et al. Regulatory CD4+CD25+ T cells in the peripheral blood of lung transplant recipients: correlation with transplant outcome. Transplantation 2004;77:762eC766.

    Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 1995;155:1151eC1164.

    Soulillou JP, Jacques Y. Monoclonal anti-IL2-receptor in organ transplantation. Transpl Int 1989;2:46eC52.

    Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol 2001;1:135eC145.

    Basu S, Binder RJ, Suto R, Anderson KM, Srivastava PK. Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-kappa B pathway. Int Immunol 2000;12:1539eC1546.

    Biragyn A, Ruffini PA, Leifer CA, Klyushnenkova E, Shakhov A, Chertov O, Shirakawa AK, Farber JM, Segal DM, Oppenheim JJ, et al. Toll-like receptor 4-dependent activation of dendritic cells by beta-defensin 2. Science 2002;298:1025eC1029.

    Termeer CC, Hennies J, Voith U, Ahrens T, Weiss JM, Prehm P, Simon JC. Oligosaccharides of hyaluronan are potent activators of dendritic cells. J Immunol 2000;165:1863eC1870.

    Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Rose J, Chow JC, Strauss JF III. The extra domain A of fibronectin activates Toll-like receptor 4. J Biol Chem 2001;276:10229eC10233.

    Johnson GB, Brunn GJ, Kodaira Y, Platt JL. Receptor-mediated monitoring of tissue well-being via detection of soluble heparan sulfate by Toll-like receptor 4. J Immunol 2002;168:5233eC5239.

日期:2007年5月14日 - 来自[2005年第171卷第9期]栏目
共 3 页,当前第 1 页 9 1 2 3 :



关闭

Copyright © 2008 39kf.com Inc. All rights reserved. 医源世界 版权所有 京ICP备05004837号
医源世界所刊载之内容一般仅用于教育目的。您从医源世界获取的信息不得直接用于诊断、治疗疾病或应对您的健康问题。如果您怀疑自己有健康问题,请直接咨询您的保健医生。医源世界、作者、编辑都将不负任何责任和义务。
本站内容来源于网络,转载仅为传播信息促进医药行业发展,如果我们的行为侵犯了您的权益,请及时与我们联系我们将在收到通知后妥善处理该部分内容
联系Email:
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

  1. Lenz, A., M. Heine, G. Schuler, and N. Romani. 1993. Human and murine dermis contain dendritic cells. Isolation by means of a novel method and phenotypical and functional characterization. J. Clin. Invest. 92:2587–2596.

  2. Meunier, L., A. Gonzalez-Ramos, and K.D. Cooper. 1993. Heterogeneous populations of class II MHC+ cells in human dermal cell suspensions. Identification of a small subset responsible for potent dermal antigen-presenting cell activity with features analogous to Langerhans cells. J. Immunol. 151:4067–4080.

  3. Baker, D.A., and S.A. Plotkin. 1978. Enhancement of vaginal infection in mice by herpes simplex virus type II with progesterone. Proc. Soc. Exp. Biol. Med. 158:131–134.

  4. Gallichan, W.S., and K.L. Rosenthal. 1996. Effects of the estrous cycle on local humoral immune responses and protection of intranasally immunized female mice against herpes simplex virus type 2 infection in the genital tract. Virology. 224:487–497.

  5. Overall, J.C., Jr., E.R. Kern, R.L. Schlitzer, S.B. Friedman, and L.A. Glasgow. 1975. Genital herpesvirus hominis infection in mice. I. Development of an experimental model. Infect. Immun. 11:476–480.

  6. Parr, M.B., L. Kepple, M.R. McDermott, M.D. Drew, J.J. Bozzola, and E.L. Parr. 1994. A mouse model for studies of mucosal immunity to vaginal infection by herpes simplex virus type 2. Lab. Invest. 70:369–380.

  7. McDermott, M.R., J.R. Smiley, P. Leslie, J. Brais, H.E. Rudzroga, and J. Bienenstock. 1984. Immunity in the female genital tract after intravaginal vaccination of mice with an attenuated strain of herpes simplex virus type 2. J. Virol. 51:747–753.

  8. Harandi, A.M., B. Svennerholm, J. Holmgren, and K. Eriksson. 2001. Differential roles of B cells and IFN-gamma-secreting CD4(+) T cells in innate and adaptive immune control of genital herpes simplex virus type 2 infection in mice. J. Gen. Virol. 82:845–853.

  9. Parr, M.B., and E.L. Parr. 1999. The role of gamma interferon in immune resistance to vaginal infection by herpes simplex virus type 2 in mice. Virology. 258:282–294.

  10. McDermott, M.R., L.J. Brais, and M.J. Evelegh. 1990. Mucosal and systemic antiviral antibodies in mice inoculated intravaginally with herpes simplex virus type 2. J. Gen. Virol. 71:1497–1504.

  11. Parr, M.B., and E.L. Parr. 1997. Protective immunity against HSV-2 in the mouse vagina. J. Reprod. Immunol. 36:77–92.

  12. King, N.J., E.L. Parr, and M.B. Parr. 1998. Migration of lymphoid cells from vaginal epithelium to iliac lymph nodes in relation to vaginal infection by herpes simplex virus type 2. J. Immunol. 160:1173–1180.

  13. Jones, C.A., T.J. Taylor, and D.M. Knipe. 2000. Biological properties of herpes simplex virus 2 replication-defective mutant strains in a murine nasal infection model. Virology. 278:137–150.

  14. Gao, M., and D.M. Knipe. 1989. Genetic evidence for multiple nuclear functions of the herpes simplex virus ICP8 DNA-binding protein. J. Virol. 63:5258–5267.

  15. Green, E.L. 1989. Biology of the Laboratory Mouse. 2nd ed. Dover Publications, New York. 716 pp.

  16. Green, E.L. 1966. Biology of the Laboratory Mouse, by the Staff of the Jackson Laboratory. 2nd ed. Dover Publications, New York. 706 pp.

  17. Iwasaki, A., and B.L. Kelsall. 2001. Unique functions of CD11b+, CD8 alpha+, and double-negative Peyer's patch dendritic cells. J. Immunol. 166:4884–4890.

  18. Iwasaki, A., and B.L. Kelsall. 1999. Freshly isolated Peyer's patch, but not spleen, dendritic cells produce interleukin 10 and induce the differentiation of T helper type 2 cells. J. Exp. Med. 190:229–239.

  19. Kelsall, B.L., and W. Strober. 1996. Distinct populations of dendritic cells are present in the subepithelial dome and T cell regions of the murine Peyer's patch. J. Exp. Med. 183:237–247.

  20. Hobson, A., A. Wald, N. Wright, and L. Corey. 1997. Evaluation of a quantitative competitive PCR assay for measuring herpes simplex virus DNA content in genital tract secretions. J. Clin. Microbiol. 35:548–552.

  21. Anjuere, F., P. Martin, I. Ferrero, M.L. Fraga, G.M. del Hoyo, N. Wright, and C. Ardavin. 1999. Definition of dendritic cell subpopulations present in the spleen, Peyer's patches, lymph nodes, and skin of the mouse. Blood. 93:590–598.

  22. Salomon, B., J.L. Cohen, C. Masurier, and D. Klatzmann. 1998. Three populations of mouse lymph node dendritic cells with different origins and dynamics. J. Immunol. 160:708–717.

  23. Borkowski, T.A., J.J. Letterio, A.G. Farr, and M.C. Udey. 1996. A role for endogenous transforming growth factor ß1 in Langerhans cell biology: the skin of transforming growth factor ß1 null mice is devoid of epidermal Langerhans cells. J. Exp. Med. 184:2417–2422.

  24. Borkowski, T.A., A.J. Nelson, A.G. Farr, and M.C. Udey. 1996. Expression of gp40, the murine homologue of human epithelial cell adhesion molecule (Ep-CAM), by murine dendritic cells. Eur. J. Immunol. 26:110–114.

  25. Henri, S., D. Vremec, A. Kamath, J. Waithman, S. Williams, C. Benoist, K. Burnham, S. Saeland, E. Handman, and K. Shortman. 2001. The dendritic cell populations of mouse lymph nodes. J. Immunol. 167:741–748.

  26. den Haan, J.M., S.M. Lehar, and M.J. Bevan. 2000. CD8(+) but not CD8(-) dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192:1685–1696.

  27. Iyoda, T., S. Shimoyama, K. Liu, Y. Omatsu, Y. Akiyama, Y. Maeda, K. Takahara, R.M. Steinman, and K. Inaba. 2002. The CD8+ dendritic cell subset selectively endocytoses dying cells in culture and in vivo. J. Exp. Med. 195:1289–1302.

  28. Pooley, J.L., W.R. Heath, and K. Shortman. 2001. Cutting edge: intravenous soluble antigen is presented to CD4 T cells by CD8- dendritic cells, but cross-presented to CD8 T cells by CD8+ dendritic cells. J. Immunol. 166:5327–5330.

  29. Janeway, C.A., P. Travers, M. Walport, and M. Shlomchik. 2001. Immunobiology. 5th ed. Garland Publishing, New York. 732 pp.

  30. Mikloska, Z., L. Bosnjak, and A.L. Cunningham. 2001. Immature monocyte-derived dendritic cells are productively infected with herpes simplex virus type 1. J. Virol. 75:5958–5964.

  31. Salio, M., M. Cella, M. Suter, and A. Lanzavecchia. 1999. Inhibition of dendritic cell maturation by herpes simplex virus. Eur. J. Immunol. 29:3245–3253.

  32. Mueller, S.N., C.M. Jones, C.M. Smith, W.R. Heath, and F.R. Carbone. 2002. Rapid cytotoxic T lymphocyte activation occurs in the draining lymph nodes after cutaneous herpes simplex virus infection as a result of early antigen presentation and not the presence of virus. J. Exp. Med. 195:651–656.

  33. Shukla, D., C.L. Rowe, Y. Dong, V.R. Racaniello, and P.G. Spear. 1999. The murine homolog (Mph) of human herpesvirus entry protein B (HveB) mediates entry of pseudorabies virus but not herpes simplex virus types 1 and 2. J. Virol. 73:4493–4497.

  34. Masopust, D., V. Vezys, A.L. Marzo, and L. Lefrancois. 2001. Preferential localization of effector memory cells in nonlymphoid tissue. Science. 291:2413–2417.

  35. Jameson, B., F. Baribaud, S. Pöhlmann, D. Ghavimi, F. Mortari, R.W. Doms, and A. Iwasaki. 2002. Expression of DC-SIGN by intestinal and genital mucosal dendritic cells in humans and rhesus macaques. J. Virol. 76:1866–1875.