【摘要】
Dendritic cells (DCs) can release microvesicles, but the latter??s numbers, size, and fate are unclear. Fluorescently labeled DCs were visualized by laser-scanning microscopy. Using a Surpass algorithm, we were able to identify and quantify per cell several hundred microvesicles released from the surface of stimulated DCs. We show that most of these microvesicles are not of endocytic origin but result from budding of the plasma membrane, hence their name, exovesicle. Using a double vital staining, we show that exovesicles isolated from activated DCs can fuse with the membrane of resting DCs, thereby allowing them to present alloantigens to lymphocytes. We concluded that, within a few hours from their release, exovesicles may amplify local or distant adaptive immunological response.
--------------------------------------------------------------------------------
Dendritic cells (DCs) are antigen-presenting cells with a unique ability to induce primary immune responses. They are present in trace amounts in most tissues, but they are particularly abundant and act as sentinels in organs providing an environmental interface, such as the skin, the respiratory system, and the gastrointestinal tract. Because of their location, immature dendritic cells (iDCs) are profoundly influenced by the environment and transmit danger signals to cells of the adaptive immune system. The presence of pathogens activates iDCs and triggers their maturation, resulting in enhanced expression of co-stimulatory molecules such as CD86 and CD80 and maturation markers such as CD83. Once activated, DCs migrate to lymph nodes where antigen presentation leads to the maturation and proliferation of specific T-cell clones, which in turn migrate to injured tissue.1
In the late 1980s, an alternative antigen pathway was identified as a complement to the classic pathway of lymphocyte activation. This alternative route involves, for instance, the release by follicular DCs of immune complex-coated bodies (iccosomes), thus increasing the delivery of immunogens to antigen-specific B cells in the lymph nodes.2,3 The various types of vesicles released into the extracellular medium from eukaryotic cells appear to have different origins: microvesicles are the result of membrane surface shedding; eg, iccosomes are produced by follicular DCs,2 argosomes carry membrane-bound morphogens, as described in Drosophila embryos,4 and exosomes are the result of an exocytosis of multivesicular bodies.5-7 Exosomes have raised immunological interest because they originate from compartments of the endocytic pathway which are sites of peptide loading on major histocompatibility complex (MHC) class II molecules.8,9
The shedding of membrane vesicle, or exovesicle, is thought to originate from the plasma membrane, using a mechanism similar to that of viral budding.10 Exovesicles bear most of the surface antigens expressed on the plasma membrane, with a selective enrichment in components including human leukocyte antigen class I molecules and integrins.11 Their diameter ranges between 0.1 and 1 µm, and their function has been associated to the function of the cell from which they originate.12,13 Many types of cells release exovesicles, but so far little is known on those originating from DCs. On the other hand, the release of exosomes by DCs has been established.14,15 Exosomes are defined as microvesicles of endocytic origin, cup-shaped, and 0.05 µm in diameter. The proteins found in the membrane are mostly related to T-cell signaling and T-cell activation, such as MHC class II, MHC class I, and CD86, but there are also adhesion molecules, such as tetraspan, and integrin proteins. The rate and relevance of the release of exovesicles versus exosomes has not yet been established.
In this study, using three-dimensional reconstructed pictures of DCs obtained by laser-scanning microscopy (LSM), we were able to identify, and quantify per cell, the secretion of microvesicles within a few hours after a danger signal such as lipopolysaccharide (LPS). These microvesicles appeared not to be of endocytic origin but seemed to be shed from the surface of DCs similar to iccosomes. Using double vital staining, we examined the interaction of exovesicles with DCs not yet activated by danger signals. We demonstrated that these exovesicles from activated DCs can fuse with the membrane of resting DCs and that they are able to transfer alloantigens to activate T cells. Our results demonstrate the origin and magnitude of the release of exovesicles by stimulated DCs potentially able to amplify even distant innate and adaptive immunity.
【关键词】 exovesicles activated dendritic dendritic allowing alloantigens
Materials and Methods
Monocyte Isolation and Differentiation to DCs
Monocytes generated from peripheral blood mononuclear cells of healthy human donors were isolated by Ficoll-Hypaque density gradient centrifugation of buffy coats as described previously,16 after spontaneous aggregation,17 and rosetting.18 In brief, Ficoll-Paque-purified peripheral blood mononuclear cells were suspended in RPMI 1640 medium (Invitrogen Life Technologies, Basel, Switzerland) supplemented with 10% fetal calf serum (Biochrome AG, Berlin, Germany), 2 mmol/L glutamine, 100 U of penicillin per ml, and 100 U of streptomycin per ml, referred to as complete culture medium containing 2 µg of polymyxin B sulfate mlC1 (Sigma-Aldrich, Buchs, Switzerland). Cells were incubated for 40 minutes at 4??C for aggregation. Rosetting was applied to deplete contaminant lymphocytes. Monocyte-enriched fractions were incubated overnight with sheep red blood cells (BioM?rieux, Geneva, Switzerland). Monocyte fractions characterized by high expression of CD14 (more than 85%) and low expression of CD83 and CD86 (less than 5%) were then isolated by Ficoll-Hypaque density gradient centrifugation. Differentiation of DCs from monocytes was performed as originally described by Sallusto and Lanzavecchia19 by culture cells in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) (10 ng mlC1) and interleukin-4 (10 ng mlC1) for 6 days. The cells were kept at 37??C in a 5% CO2 humidified atmosphere. On day 3, the culture medium was replaced with fresh medium.
Stimulation of DCs, Co-Cultures, and Labeling
After 6 days in culture, DCs were washed and suspended at a density of 1 x 106 cells/ml in serum-free media (RPMI 1640 medium). Cells stimulated or not with 100 ng of LPS were labeled with VIBRANT cell labeling solution DiO (3,3'-dioctadecyloxacarbocyanine perchlorate), and for co-culture conditions, either with DiO or with DiI (1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate) (Molecular Probes, Leiden, The Netherlands) for 10 minutes at 37??C and 5% CO2. After labeling, cells were washed three times with RPMI 1640 in 37??C prewarmed media and suspended in a collagen cell culture system (Chemicom, Hofheim, Germany). Cells were incubated at 37??C in 5% CO2, until they were analyzed by LSM.
Exovesicle Purification
Exovesicles were isolated using the standard process of a series of differential ultracentrifugation and filtration described previously.20,21 DCs cultured for 6 days were cultured in RPMI 1640 supplemented with 1% glutamine and 1% microvesicle-free human serum obtained by ultracentrifugation (110,000 x g) of the serum for 2 hours. DCs were stimulated or not with LPS (100 ng/ml) for 24 hours. The supernatant of 10 x 106 DCs was collected, and exovesicles were purified by centrifugation at 250 x g for 8 minutes as described previously20 and then run through 0.22-µm filters to eliminate large debris. The filtered supernatant was ultracentrifuged at 110,000 x g for 1 hour. Exovesicles were washed once with RPMI 1640 and pelleted by ultracentrifugation at 110,000 x g for 1 hour. Then the pellet was resuspended in 150 µl of RPMI 1640 media. The same media without cells following the same procedure of exovesicle isolation was used as control.
Lymphocyte Proliferation Assays
To perform mixed lymphocyte reactions (MLRs), 1 x 104 iDCs were co-cultured with 1 x 105 autologous lymphocytes with or without exovesicles purified from 10 x 106 autologous or heterologous pretreated DCs as described before. Co-cultures were done in triplicate in a final volume of 0.2 µl of RPMI, supplemented with 5% human serum and 2 mmol/L glutamine. The co-cultures were incubated for 6 days in a 5% CO2 atmosphere and proliferation was measured by the incorporation of methyl-thymidine (0.5 µCi/well), which was added to the co-culture for the last 18 hours.
Laser-Scanning Microscopy
For LSM analysis, a Zeiss LSM 510 Meta with an inverted Zeiss microscope (Axiovert 200M, lasers: HeNe 543 nm and Ar 488 nm; Carl Zeiss A.G., Feldbach, Switzerland) was used. Optical sections were taken with a 63x/1.4 Plan-Apochromat objective. This resulted in a voxel dimension of 0.1 x 0.1 x 0.25 µm in combination with a digital zoom. Image processing and visualization were done using IMARIS, a three-dimensional multichannel image processing software for LSM images (Bitplane AG, Zurich, Switzerland). To quantify the released exovesicles, the IsoSurface mode of the Surpass module in IMARIS was used, and an intensity threshold was applied to create a model of the data visualized as a solid surface. The cellular body and intracellular objects were removed manually before counting the number of extracellular objects. For this quantification, all microscope settings were kept constant during one experiment, ie, for control as well as treated cultures. All settings used for the image single restoration were also equal. The cells were chosen at random; the only criteria was that in the acquisition field an individual cell had to be present to avoid superposition of microvesicle structures from neighboring cells. Co-localization analysis was performed with the IMARIS co-localization module.
Processing of Cells for Transmission Electron Microscopy (TEM)
For TEM analysis of DCs stimulated or not with LPS, the cells were resuspended in complete culture medium containing 1.2% alginate.22 In the case of exovesicle characterization, the pellet of purified exovesicles was resuspended in complete culture medium containing 1.2% alginate. Drops of the media were suspended carefully in CaCl2 (50 mmol/L) solution for 1 hour to allow the matrix formation and DC immobilization. DCs or exovesicles in alginate drops were fixed in 2.5% phosphate-buffered glutaraldehyde solution, postfixed in 2% osmium tetroxide in 0.1 mol/L sodium cacodylate buffer, and contrasted in 0.5% uranyl acetate in 0.05 mol/L maleate buffer. This was followed by dehydration in a graded series of ethanol (70, 80, 96, and twice in 100%) and gradual replacement of ethanol by propylene oxide before the cells were infiltrated and embedded in epoxy resin. Ultrathin sections were cut using a Reichert Austria ultramicrotome and transferred onto 200-mesh uncoated copper grids, stained with uranyl acetate, counterstained with lead citrate according to standard methods,23 and finally observed with a Philips 300 TEM at 60 kV (FEI Company Philips Electron Optics, Zurich, Switzerland).
Data are expressed as mean values with the SEM. The statistical analysis was performed using SigmaStat for Windows (Version 3.10; Systat Software, Inc., or Excel for Windows) statistical software. Two groups were compared using Student??s t-test. P < 0.05 was considered significant.
Exovesicles from DCs Can Be Identified and Quantified by LSM
DC-secreted microvesicles were evidenced above all by transmission electron microscopy and quantified by Bradford analysis.24-26 To determine the dynamics of exovesicle release as well as identify their origin, we analyzed the release and quantification of exovesicles from blood monocyte-derived DCs. The cells were stained with DiO, a lipophilic fluorescent green probe, which is incorporated into the membrane lipid bilayers of living cells. The cells were cultured in a collagen matrix to immobilize the cells and visualize the released vesicles after LPS stimulation.
Cell image acquisition was done by LSM. To improve the visualization of the three-dimensional data set, shadow projection (IMARIS) from top (Figure 1A) or volume rendering from the side (Figure 1B) was performed. However, these visualization modes have not yet provided an identification of objects released from the cell body. Therefore, the cells were further analyzed using the IsoSurface mode of the Surpass module in IMARIS by applying a surface algorithm (Figure 1C) . The object was then segmented into individual objects, which separated the cell body from external objects, ie, the microvesicular structures (Figure 1D) . After removing the cell body as well as intracellular objects, the external objects could be visualized (Figure 1E) . Exovesicles were clearly detached from the DCs and were shown to be distinct from pseudopods. These exovesicles had a heterogeneous morphology and were different in size. Precise confocal data could be used for the analysis of these exovesicles, particularly for their quantification.
Figure 1. Visualization of individual objects by combining LSM and advanced digital image restoration. Cells were cultured in a collagen matrix to immobilize the cells and released vesicles after LPS stimulation for 24 hours. All images represent the same confocal data set taken from one cell. A: Three-dimensional reconstruction from top; B: volume rendering from the side; CCE: surface rendering from the cell (green), segmented into individual objects (cell body yellow, external objects turquoise).
DC Exovesicle Release Is Dependent on Danger Signals Such as LPS
The number of exovesicles released after 2, 6, and 24 hours in the matrix with or without LPS stimulation was quantified. In Figure 2A , exovesicles are shown surrounding the cells. In control cultures, the number of external objects increased transiently in a time-dependent manner, and the number increased up to three to four times when cells had been activated with LPS. The data are summarized in Figure 2B . Whereas iDCs released spontaneously 45 (SD, 25) to 120 (SD, 81) exovesicles per cell, the number of vesicles released by LPS-stimulated DCs was much higher, up to 247 (SD, 125) per cell after 24 hours of stimulation, with a peak value of 362 (SD, 128) at 6 hours. The diameter of these particles was between 0.1 and 5 µm, and 90% of them had a diameter between 0.2 and 0.4 µm (Figure 2C) . No significant difference in size was observed between unstimulated or LPS-stimulated in an early (6 hours) or late (24 hours) release exovesicles. This finding suggests that DCs are able to respond to danger signals by releasing exovesicles of different sizes, including those consistent with an endosomatic origin (exosomes from 0.05 to 0.09 µm), although most of them are larger exovesicles probably budding from the plasma membrane.
Figure 2. Visualization and quantification of released exovesicles. A: LSM images of iDC compared with LPS-maturated DCs after 2 (a, d), 6 (b, e), and 24 (c, f) hours. iDCs (aCc) and LPS-DCs (dCf), in collagen matrix, showing the release of exovesicles (turquoise vesicles) at different time points. B: Total amount of exovesicles released by DCs, calculated by the IMARIS software at the different time points, ie, 2, 6, and 24 hours. Data are expressed as mean ?? SD of two experiments with scanning of 8 to 10 cells each by LSM. The asterisk represents a statistically significant difference (P < 0.01) between LPS-treated and control groups. C: Size frequency of exovesicles, calculated by the Surpass module software in IMARIS, of DCs and LPS-stimulated DCs at 6 and 24 hours in the co-culture conditions. Bars are means ?? SD of nine data sets.
DCs Release Mostly Microvesicles Budding from the Cell Surface
TEM micrographs of DCs immobilized in alginate matrix display cells with the absence of apoptotic features such as DNA fragmentation or chromatin condensation and small spherical bodies (Figure 3A) surrounding cells. These microvesicles appear budding from the plasma membrane and to lay free, separated from the cells (inset A' and A'', arrows). After isolation of exovesicles by ultracentrifugation, the pellet was resuspended in the alginate matrix. We observed some of these exovesicles trapped in the matrix (Figure 3B) with different shapes. These exovesicles contained no prominent organelles and had a lipid bilayer cell membrane. We observed some material released by endosomal exocytosis, which might be related to the release of exosomes previously described.25,27 However, this form of microvesicles appeared to be insignificant. These results suggest that DCs are able to release many microvesicles, most of them budding from the surface or from the elongated processes of DCs. We consider this process as an exovesicle production, identical to that previously described.12,13
Figure 3. TEM of human DCs processed using alginate matrix. A: LPS-DCs cultivated for 6 hours in alginate matrix showing cell bodies and ruffling of the plasma membrane. In our TEM analysis, we confirm the absence of extensive apoptosis or apoptotic bodies. Insets A' and A'' show exovesicle (arrows) close to the cell. Inset A' shows details of exovesicle budding (arrowhead). B: Characterization of LPS-DC-derived exovesicles. Exovesicles from 10 x 106 LPS-DCs obtained after filtration and ultracentrifugation were resuspended in alginate. Different shapes of exovesicles are seen with a bilayer lipid membrane and suspended in the matrix.
Exovesicles Released from Stimulated DCs Can Fuse with the Cytoplasmic Membrane of Resting DCs in Co-Cultures
To test the ability of exovesicles to fuse with resting DCs in their vicinity, DCs were stimulated for 12 hours with 100 ng of LPS and stained with the fluorescent probe DiI (red) (LPS-DC). Prelabeled iDCs with the DiO (green) fluorescent probes were co-cultured with LPS-DCs in a collagen matrix. Cells were investigated after 6 and 24 hours, and the incorporation of the red fluorescence (LPS-DCs) in green labeled cells (iDCs) related to the cell volume was analyzed using the co-localization module in IMARIS.
When iDCs were co-cultured with control cells (no LPS stimulation), only a small amount of incorporated red material could be seen in green labeled cells, even if the cells were in close contact, as shown in Figure 4A . Conversely, when iDCs were co-cultured with stimulated LPS-DCs, at an early time (6 hours), nonstimulated DCs incorporated labeled vesicles into their membrane, as shown by the incorporation of red material (Figure 4B) . The number of co-localized voxels was analyzed. It resulted in 15.2 (SD, 9.4) co-localized voxels per µm3 for iDC co-cultures with LPS-DCs, compared with 5.2 (SD, 5.5) co-localized voxels per µm3 in control co-cultures (Figure 4B) . The number of co-localized voxels decreased after 24 hours and was 4.2 (SD, 5.3) voxels per µm3 for iDC co-cultures with LPS-DCs, compared with 1.4 (SD, 3.1) voxels per µm3 in control cultures (Figure 4B) . The rate of internalization of DC exovesicles was low compared with the fusion (Figure 4B) , which suggests that exovesicles lodged within the cell surface membrane probably play a role in antigen presentation.
Figure 4. Co-localization analysis of the incorporation of red-labeled exovesicles into green-labeled cells. Three-dimensional data of DiO-labeled iDCs (green) co-cultured with DiI-labeled LPS-treated DCs (red) in collagen matrix were taken with LSM and co-localization analysis was performed. A: Co-cultures of control cells (red and green). No red signal is seen in green cells. B: Exovesicles released from LPS-stimulated DCs fuse with the plasma membrane of iDCs, as shown by the incorporation of red material (yellow indicates co-localization of green and red, arrows). Little intracellular red material is seen (arrowhead). Images represent xy- and xz-projections; yellow arrowheads mark the position of projections. Insets represent three-dimensional reconstructions from the same data sets. C: Quantification of co-localized voxels related to the volume (µm3) in the plasma membrane of iDCs in the co-culture of nonstimulated DCs (iDC DiO C iDC DiI) or in the co-culture with LPS-stimulated DCs (iDC DiO C LPS-DC DiI). Data are expressed as mean ?? SD of three experiments with LSM scanning of 10 cells each. The asterisk represents a statistically significant difference (P < 0.02) between LPS-treated and control groups.
LPS-DCs Co-Cultured with Resting DCs Induce the Release of Exovesicles by Resting DCs
We examined the ability of iDCs to release exovesicles at 6 and 24 hours in the vicinity of DCs previously activated for 12 hours by LPS and washed or in contact with control DCs. Figure 5A shows one activated DC in co-culture for 24 hours with a nonactivated iDC. The iDC has incorporated red material (Figure 5A '). The release of external objects from such nonactivated iDCs which had fused with exovesicles was analyzed as described for directly stimulated DCs. Our results show that nonstimulated co-cultured DCs were able to release exovesicles very early on (Figure 5B) , with a mean of 7 (SD, 4) exovesicles during the first 6 hours and 88 (SD, 84) exovesicles after 24 hours. When resting DCs were co-cultured with LPS-matured DCs, the number of exovesicles increased from 21 (SD, 18) at 6 hours to 442 (SD, 276) at 24 hours. This suggests that, even though they were not directly stimulated with LPS, resting iDCs were able to sense a danger signal by fusing LPS-DCs exovesicles within their own membrane. They were then able to respond themselves by releasing a new burst of exovesicles, whereas LPS-DCs, after 24 hours, produced only very small numbers.
Figure 5. Release of exovesicles from iDCs in the vicinity of mDCs. A: LSM image of DiO-labeled iDCs (green) co-cultured with DiI-labeled LPS-stimulated DCs (red) in collagen matrix for 24 hours. In A', incorporated red material can be observed (arrows). A: Three-dimensional reconstruction; A': xy- and xz-projections from the same data set; yellow arrowheads mark the position of projections. B: Diagram showing total amount of external objects released by iDCs in the co-culture of nonstimulated DCs (left panels) or in the co-culture with LPS-stimulated DCs (right panels). Data are expressed as mean ?? SD of two experiments with LSM scanning of 8 to 10 cells each. The asterisk represents a statistically significant difference (P < 0.001) between LPS-treated and control groups.
Exovesicles from DCs Confer Alloantigen Presenting Capacity
Exovesicles may harbor molecules from the DCs from which they originated, among which there may be major histocompatibility antigens and co-stimulatory molecules.7 These exovesicles may thus confer antigen presentation capacity to the DCs with which they fused. To determine the functional role of these exovesicles released from DCs, exovesicles contained in culture supernatants of LPS-activated or nonactivated DCs were purified using the standard ultracentrifugation and filtration process described in Materials and Methods. For the MLR, DCs were co-cultured with syngeneic lymphocytes at a constant concentration with or without exovesicles from syngeneic or allogeneic DCs. Exovesicles from LPS-stimulated allo-iDCs were able to elicit T-cell proliferation after 6 days of incubation (Figure 6) . In five independent experiments, the intensity of T-cell stimulation was 3.5-times increased with exovesicles derived from allo-LPS-DCs than with exovesicles derived from allo-iDCs with a respective proliferation of 30,178 cpm (SEM ??13,273) compared with 8759 cpm (SEM ??4573) in the control condition (P < 0.05). In the experiment in which exovesicles derived from LPS-DCs were co-cultured with allogeneic lymphocytes without APCs, there was no significant induction of T-cell proliferation, indicating that DCs were required to induce alloantigen proliferation of T cells. In two control experiments, autologous MLR presentation (AMLR) was observed when syngeneic DCs and T cells were also incubated with syngeneic exovesicles from LPS-activated DCs. However, this AMLR reached 55% proliferation induced by allogeneic vesicles derived from LPS-stimulated DCs. One representative experiment with all controls is shown in Figure 6 .
Figure 6. Analysis of antigen-presenting function of DCs by exovesicles. MLR was used to assess the stimulatory function of exovesicles. DCs (DC1) were co-cultured with syngeneic lymphocytes (T1) at a constant concentration with or without exovesicles isolated from allogeneic pretreated DCs (DC2 and DC2-LPS) or syngeneic pretreated DCs (DC1 and DC1-LPS) as controls, as described in Materials and Methods. DC1/T1 cell ratio was 1:10. The co-cultures were incubated for 6 days and proliferation was measured by the incorporation of tritiated thymidine. One of five independent experiments, done in triplicate, is shown. Results are expressed as means ?? SD. One asterisk represents a statistically significant difference (P < 0.01) compared with T1 + DC1 + Exo (DC2) control conditions, and two asterisks represents a statistically significant difference (P < 0.05) compared with T1 + DC1 + Exo (DC1-LPS) control condition.
The major outcome of our work was to visualize and quantify for the first time the amount of exovesicles released per DC, particularly on LPS stimulation, using LSM in combination with advanced image restoration. With the Surpass module in IMARIS, we were able to quantify up to 900 exovesicles around stimulated cells. Various sizes were observed, with small vesicles of 0.05 µm as well as larger vesicles ranging from 0.1 to 1 µm, 90% of which ranging from 0.2 to 0.4 µm. However, there was no difference in size between vesicles released after 6 hours and after 24 hours of LPS or control conditions. Despite the fact that a variety of shapes was observed, the proportion of microvesicles with a size similar to that of exosomes (0.05 to 0.09 µm) was low (less than 5%), suggesting that exosomes could be released in smaller amounts than exovesicles. After labeling the cell membrane with DiO tracer, internalization of the labeled plasma membrane to form endosomes and then multivesicular endosomes was observed only occasionally. Therefore, we hypothesized that at least 90% of the microvesicles released were shed from the plasma membrane.
TEM was used to morphologically characterize DCs by the presence of elongated processes. As shown in Figure 3 , DCs were able to release microvesicles of various shapes and sizes, with a single membrane and a homogenous content. These exovesicles visualized by TEM originated from cells that did not have a dense nucleus, typical of cells undergoing apoptosis, and they were very few structures consistent with apoptotic bodies (<2%) of 1 to 4 µm in size.28
Nonactivated DCs release exovesicles in a process similar to the release of exosomes described in the literature.15 This is demonstrated by the constant increase in numbers released from an early time (2 hours) up to 24 hours. However, when DCs are activated, the release increases early on (2 hours) before reaching a peak at 6 hours (Figure 2B) . If we correlate these time points with the different stages of DC life, ie, recruitment, antigen uptake, and initial migration to lymph nodes, those exovesicles might be deemed to play a particular role in innate immune response and initial inflammation. Recently, MacKenzie and co-workers29 demonstrated that microvesicles from activated monocytes contain bioactive IL-1ß, which was able to stimulate IL-1 receptors on other cells. This supports our hypothesis that exovesicles might be involved in the early stages of inflammation.
Our finding that the number of exovesicles released from activated DCs is higher than that produced by resting DCs may contradict the results from other authors,24,30 who reported that the release of what they name exosomes decreases on maturation of DCs (mDCs), and that mDCs consistently secrete approximately two to three times less exosomes than iDCs, probably attributable to a reduction of endosomatic activity during maturation.15,24 However, besides the total amount released significantly higher at all time points with LPS-DCs than with iDCs, we observed special kinetics of the exovesicle release from LPS-DCs. The release peaked at 6 hours and decreased at 24 hours, showing that exovesicles as was demonstrated by exosomes24 can be developmentally regulated as a function of the maturation of DCs.
DCs were immobilized in a three-dimensional cell collagen culture system. In the co-culture system, we observed that microvesicular structures released from activated DCs can migrate and fuse with the membrane of resting DCs. This phenomenon was measured by counting the number of voxels in the membrane of resting DCs, which was high early on (6 hours) and decreased at 24 hours. This decrease may reflect the amount of vesicles available or a reduced capacity to integrate external material, which can be correlated with the maturation process of DCs fusing with microvesicles. Indeed, once the cells have integrated the exovesicles, they may be activated and lose some of their absorption capacity31 and enhance the turnover of their membrane component, thereby decreasing the visibility of the fused microvesicles on their surface. In addition, at the same time point, this matured cell increased its release of exovesicles as shown in Figure 5B . This supports the idea that exovesicles play a role as immunological messengers leading to the maturation/activation of neighboring DCs. This property could be linked with soluble or membrane-bound mediators as previously suggested29 or to the release of cytoplasmic components in the cells with which microvesicles did fuse.
The ability to prime naive T cells constitutes a unique and critical function of DCs. Despite this, exosomes have been shown to mediate transfer of membrane material between different cells, but it is not clear whether these microvesicles modulate T-cell tolerance or priming. Internalization of microvesicles has been demonstrated with a transfer of functional MHC class I to acceptor DCs for presentation to CD8+ T cells.32 In addition, exosomes from iDCs or mDCs display different qualitative protein composition.15
In our experiments, exovesicles released by allogeneic LPS-DCs transferred to resting DCs the capacity to prime T cells. We have shown that exovesicles were released as a function of danger signals; they could fuse with the membrane of resting DCs, transferring the capacity of matured cells to iDCs to present alloantigen to T cells. The microvesicular structures fused with iDCs might play a role in the activation of resting DCs but imply also the transfer of allo-MHC molecules and perhaps accessory molecules to allow MLR to be induced. Indeed, exovesicles isolated from LPS-stimulated autologous DCs are able to increase AMLR but at a rate still significantly lower than exovesicles isolated from allogeneic DCs, reflecting that this process is not a carryover of LPS but an increase of MHC on the DC surface. However, exovesicles released spontaneously by resting allogeneic or syngeneic DCs do not activate T cells. Our results corroborate the results of other authors, in which quiescent DCs were shown to help maintain a state of peripheral T-cell tolerance, as demonstrated by Shortman and Liu,33 thereby showing that exovesicles from resting DCs might contribute to tolerance. Furthermore, our experiments corroborate the fact that those vesicles do not present alloantigens to activate T cells but required the presence of DCs,34 thereby supporting the idea that these exovesicles are functionally very similar to exosomes and alone do not support T-cell proliferation.
In summary, the data generated by LSM and TEM provide new insights in the release of exovesicles from DCs. Overall, DCs are able to release numerous exovesicles from their plasma membrane in response to danger signals, a mechanism that appears to be much more prominent than the release of exosomes from multivesicular endosomes. Those exovesicles released from activated cells were integrated in the membrane of adjacent resting DCs, which in turn induced an activation and release of exovesicles from the plasma membrane. These exovesicles could transfer MHC molecules and antigens such as alloantigens to be presented by neighboring DCs to T cells.
We thank Denise Howald, Ursula Gerber, and Sandra Frank for their excellent technical assistance. We are also thankful to Marius Messerli, the owner of the Bitplane (Imaris/Surpass Software).
【参考文献】
Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K: Immunobiology of dendritic cells. Annu Rev Immunol 2000, 18:767-811
Szakal AK, Kosco MH, Tew JG: A novel in vivo follicular dendritic cell-dependent iccosome-mediated mechanism for delivery of antigen to antigen-processing cells. Immunology 1988, 140:341-353
Tew JG, Kosco MH, Szakal AK: The alternative antigen pathway. Immunol Today 1989, 10:229-232
Cadigan KM: Regulating morphogen gradients in the Drosophila wing. Semin Cell Dev Biol 2002, 13:83-90
Heijnen HF, Schiel AE, Fijnheer R, Geuze HJ, Sixma JJ: Activated platelets release two types of membrane vesicles: microvesicles by surface shedding and exosomes derived from exocytosis of multivesicular bodies and alpha-granules. Blood 1999, 94:3791-3799
Taverna S, Ghersi G, Ginestra A, Rigogliuso S, Pecorella S, Alaimo G, Saladino F, Dolo V, Dell??Era P, Pavan A, Pizzolanti G, Mignatti P, Presta M, Vittorelli ML: Shedding of membrane vesicles mediates fibroblast growth factor-2 release from cells. J Biol Chem 2003, 278:51911-51919
Hugel B, Martinez MC, Kunzelmann C, Freyssinet JM: Membrane microparticles: two sides of the coin. Physiologist 2005, 20:22-27
West MA, Lucocq JM, Watts C: Antigen processing and class II MHC peptide-loading compartments in human B-lymphoblastoid cells. Nature 1994, 369:147-151
Th?ry C, Zitvogel L, Amigorena S: Exosomes: composition, biogenesis and function. Nat Rev Immunol 2002, 2:569-579
Dainiak N: Surface membrane-associated regulation of cell assembly, differentiation, and growth. Blood 1991, 78:264-276
Miguet L, Pacaud K, Felden C, Hugel B, Martinez MC, Freyssinet JM, Herbrecht R, Potier N, van Dorsselaer A, Mauvieux L: Proteomic analysis of malignant lymphocyte membrane microparticles using double ionization coverage optimization. Proteomics 2006, 6:153-171
Vittorelli ML: Shed membrane vesicles and clustering of membrane-bound proteolytic enzymes. Curr Top Dev Biol 2003, 54:411-432
Hägerstrand H, Isomaa B: Lipid and protein composition of exovesicles released from human erythrocytes following treatment with amphiphiles. Biochim Biophys Acta 1994, 1190:409-415
Taïeb J, Chaput N, Zitvogel L: Dendritic cell-derived exosomes as cell-free peptide-based vaccines. Crit Rev Immunol 2005, 25:215-223
Segura E, Amigorena S, Thery C: Mature dendritic cells secrete exosomes with strong ability to induce antigen-specific effector immune responses. Blood Cells Mol Dis 2005, 35:89-93
Obregon C, Dreher D, Kok M, Cochand L, Kiama GS, Nicod LP: Human alveolar macrophages infected by virulent bacteria expressing SipB are a major source of active interleukin-18. Infect Immun 2003, 71:4382-4388
Mentzer SJ, Guyre PM, Burakoff SJ, Faller DV: Spontaneous aggregation as a mechanism for human monocyte purification. Cell Immunol 1986, 101:312-319
Armant M, Rubio M, Delespesse G, Sarfati M: Soluble CD23 directly activates monocytes to contribute to the antigen-independent stimulation of resting T cells. J Immunol 1995, 155:4868-4875
Sallusto F, Lanzavecchia A: Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994, 179:1109-1118
Th?ry C, Boussac M, Veron P, Ricciardi-Castagnoli P, Raposo G, Garin J, Amigorena S: Proteomic analysis of dendritic cell-derived exosomes: a secreted subcellular compartment distinct from apoptotic vesicles. J Immunol 2001, 166:7309-7318
Raposo G, Nijman HW, Stoorvogel W, Liejendekker R, Harding CV, Melief CJ, Geuze HJ: B lymphocytes secrete antigen-presenting vesicles. J Exp Med 1996, 183:1161-1172
Page AM, Lagnado JR, Ford TW, Place G: Calcium alginate encapsulation of small specimens for transmission electron microscopy. J Microsc 1994, 175:166-170
Im Hof V, Scheuch G, Geiser M, Gebhart J, Gehr P, Heyder J: Techniques for the determination of particle deposition in lungs of hamsters. J Aerosol Med 1989, 2:247-259
Thery C, Regnault A, Garin J, Wolfers J, Zitvogel L, Ricciardi-Castagnoli P, Raposo G, Amigorena S: Molecular characterization of dendritic cell-derived exosomes. Selective accumulation of the heat shock protein hsc73. J Cell Biol 1999, 147:599-610
Pan BT, Teng K, Wu C, Adam M, Johnstone RM: Electron microscopic evidence for externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J Cell Biol 1985, 101:942-948
Wolfers J, Lozier A, Raposo G, Regnault A, Thery C, Masurier C, Flament C, Pouzieux S, Faure F, Tursz T, Angevin E, Amigorena S, Zitvogel L: Tumor-derived exosomes are a source of shared tumor rejection antigens for CTL cross-priming. Nat Med 2001, 7:297-303
Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C: Exosomal-like vesicles are present in human blood plasma. Int Immunol 2005, 17:879-887
Hristov M, Erl W, Linder S, Weber PC: Apoptotic bodies from endothelial cells enhance the number and initiate the differentiation of human endothelial progenitor cells in vitro. Blood 2004, 104:2761-2766
MacKenzie A, Wilson HL, Kiss-Toth E, Dower SK, North RA, Surprenant A: Rapid secretion of interleukin-1beta by microvesicle shedding. Immunity 2001, 15:825-835
Utsugi-Kobukai S, Fujimaki H, Hotta C, Nakazawa M, Minami M: MHC class I-mediated exogenous antigen presentation by exosomes secreted from immature and mature bone marrow derived dendritic cells. Immunol Lett 2003, 89:125-131
Morelli AE, Larregina AT, Shufesky WJ, Sullivan ML, Stolz DB, Papworth GD, Zahorchak AF, Logar AJ, Wang Z, Watkins SC, Falo LD, Jr, Thomson AW: Endocytosis, intracellular sorting, and processing of exosomes by dendritic cells. Blood 2004, 104:3257-3266
Andre F, Chaput N, Schartz NE, Flament C, Aubert N, Bernard J, Lemonnier F, Raposo G, Escudier B, Hsu DH, Tursz T, Amigorena S, Angevin E, Zitvogel L: Exosomes as potent cell-free peptide-based vaccine. I. Dendritic cell-derived exosomes transfer functional MHC class I/peptide complexes to dendritic cells. J Immunol 2004, 172:2126-2136
Shortman K, Liu YJ: Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002, 2:151-161
Th?ry C, Duban L, Segura E, Veron P, Lantz O, Amigorena S: Indirect activation of naive CD4+ T cells by dendritic cell-derived exosomes. Nat Immunol 2002, 3:1156-1162
作者单位:From the Department of Clinical Research,* Division of Pneumology, and the Institute of Anatomy, University of Bern, Bern, Switzerland; and the Department of Veterinary Anatomy and Physiology, University of Nairobi, Nairobi, Kenya
1 Medicine A, University Hospital, CH-4031 Basel, Switzerland
2 University Health Network, Departments of Medical Biophysics and Immunology, University of Toronto, Toronto, Ontario M5S 1A8, Canada
3 Department of Pathology, University Hospital, CH-8091 Zurich, Switzerland
4 IMBA, Institute for Molecular Biotechnology of the Austrian Academy of Sciences, A-1030 Vienna, Austria
5 Molecular Biomedicine, Swiss Federal Institute of Technology, CH-8952 Zurich, Switzerland
| Abstract |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
Key Words: dendritic cells • interleukin 1 • interleukin 1 receptor type 1 • autoimmunity • myocarditis
| Introduction |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
IL-1 is a multifunctional player during host defense and disease. It stimulates the acute phase response, the secretion of matrix metalloproteinases, chemokines, and other proinflammatory cytokines, acts as endogenous pyrogen, and activates lymphocytes (11, 12). In the context of autoimmunity, IL-1 promotes collagen-induced arthritis in mice (13–15) and plays an important role in the pathogenesis of rheumatoid arthritis in humans (16). In fact, IL-1 antagonists are already used to treat patients with rheumatoid arthritis. IL-1 is produced by a variety of cell types including macrophages, B cells, T cells, and dendritic cells (DCs). Two forms of biologically active IL-1 exist, IL-1 and IL-1ß, which exert similar activities through the IL-1R type 1 (IL-1R1; CD121a). The IL-1R type 2 (IL-1R2; CD121b) is not considered to be involved in the signal transduction, but acts as a "decoy" receptor that can be shed from the cell surface and prevents IL-1 binding to the IL-1R type 1 (17). In addition, an endogenous IL-1R antagonist (IL-1ra) has been identified that binds to IL-1 receptors and blocks IL-1 binding and signaling (12).
The development of Coxsackie virus B3 (CVB3)-induced myocarditis is associated with the infiltration of the heart with inflammatory cells that secrete IL-1, and treatment with recombinant IL-1 enhances CVB3 myocarditis in partially resistant mice (18, 19). Furthermore, expression of IL-1R antagonist in the mouse heart by plasmid DNA decreases myocardial inflammation in CVB3 myocarditis (20). However, the role of IL-1 and the IL-1R1 during inflammatory heart disease has not been established on the genetic level. Our data provide the first in vivo evidence that IL-1R1 triggering on DCs is critical for expansion of autoreactive CD4+ T cells and subsequent induction of autoimmune heart disease.
| Materials and Methods |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
Histopathology and Immunohistochemistry.
21 d after the immunization, hearts were removed and processed for hematoxylin-eosin staining. Myocarditis was scored on a semiquantitative scale using grades from 0 to 4 (0: no inflammatory infiltrates; 1: small foci of inflammatory cells between myocytes; 2: larger foci of >100 inflammatory cells; 3: >10% of a cross section involved; 4: >30% of a cross section involved). For immunohistochemistry, OTC embedded frozen hearts were fixed in acetone and then processed for antibody staining according to standard protocols. The following antibodies were used: anti-MHC II (biotinylated; Serotec; MCA46B), anti-CD45R (RA3–6B2), anti-CD3 (KT3–1.1), anti-CD4 (YTS 191), anti-CD8 (YTS 169), anti-VCAM-1 mAb (0.5 mg/ml, clone 429; ), anti-ICAM-1 (20 mg/ml, clone 3E2; ); anti-Mac-1 (rat IgG, biotinylated), anti-CD11c (2.5 mg/ml, clone HL3; ), anti-Gr-1/Ly-6G (0.2 mg/ml, clone RB6–8C5; ).
Proliferation Assays.
CD4+ T cells were purified from draining lymph nodes of immunized mice using magnetic beads (CD4+ T cell isolation kit; Miltenyi Biotech) and cultured for 72 h together with irradiated (2,000 rad) syngenic splenocytes, with or without 10 µg/ml of myhc 614–634 in serum-free AIM-V/myhc(614–629) ( ) medium. Proliferation was assessed by measuring [3H]methyl-thymidine incorporation. IFN-, IL-2, IL-10, and IL-4 levels in supernatants were measured using commercially available ELISA kits (Quantikine; R&D Systems) after 40 h of culture in the presence of myhc-. For in vitro stimulation assays of primary CD4+ T cells, naive CD62L-positive CD4+ T cells were isolated from lymph nodes by depletion/positive selection with magnetic beads (CD4+ isolation kit, CD62L microbeads, MACS; Miltenyi Biotech). 105 CD4+ CD62L+ cells were then stimulated by 5 µg/ml soluble anti-CD3, 5 µg/ml anti-CD3 and 1 µg/ml anti-CD28, 50 ng/ml PMA and 500 ng/ml Ionomycin, or with 1 µg/ml Concanavalin A together with 0.25 x 105 irradiated (1,500 rad) purified nonstimulated DCs. Proliferative responses were assessed after 24 or 48 h in serum free AIM-V ( ) medium at 37°C/5% CO2 by measuring [3H]methyl-thymidine incorporation.
Generation of DCs, Cytokine Measurements, and FACS® Analysis.
DCs were generated as described (22). CD11c positive cells were further enriched by positive selection using magnetic beads (MACS; Miltenyi Biotech). Generally, FACS® analysis for CD11c expression and microscopic assessment of the typical cell morphology revealed over 80% of DCs. For cytokine measurements, DCs were plated at 106/ml in 24 well plates and incubated for 24 h with various stimuli including 5 µg/ml anti-CD40, 1 µg/ml LPS, 5 µg/ml anti-CD40, and 1 µg/ml LPS, 500 U/ml TNF-, or 10 ng/ml of IL-1ß. TNF-, IL-1ß, IL-12p70, and IL-6 were measured using Quantikine ELISA kits (R&D Systems). For FACS® analysis, DC preparations were preincubated for 30 min at 4° with Fc-block ( ) and 1% rat serum in staining buffer before incubation with the appropriate fluorochrome labeled antibodies from .
Adoptive Transfer of In Vitro–restimulated CD4+ T Cells and DC Treatment Protocol.
Spleens from donor mice were removed 21 d after the first immunization. CD4+ T cells were enriched using magnetic beads (MACS; Miltenyi Biotech) and cultured for 48 h on antigen pulsed and irradiated (1,500 rad) syngenic DCs. 5 x 106 CD4+ T cells per mouse (>98% CD4+ cells) were intraperitoneally injected in to SCID (IL-1R1+/+) mice. Recipients were killed 10 d after transfer, and myocarditis severity was assessed.
For in vivo reconstitution with antigen-pulsed DCs, we generated immature DCs by adding 20 ng/ml of IL-10 to the culture medium. 1 d prior to harvesting, cells were pulsed overnight with the myhc- peptide at 10 µg/ml. After enrichment of CD11c-positive cells using magnetic beads, 2 x 105 CD11c+MHC class IIlow+ DCs per mouse were intraperitoneally injected 6 h before immunization with myhc- and CFA on days 0 and 7.
| Results |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
Members of the IL-1R/Toll-like receptor (TLR) superfamily including IL-1R1 and IL-18R commonly induce the signaling cascade MyD88 IRAK1/IRAK2 TRAF6 leading to the activation of the transcription factor nuclear factor (NF)-B, p38 mitogen-activated protein kinase (MAPK), and Jun-N terminal kinase. The NF-B pathway appears to play an important role in the development of autoimmune diseases and inactivation ameliorates EAE (24) and collagen-induced arthritis (25, 26), which has been implicated with the inhibition of Th1 responses. NF-B may promote the production of IFN- by T cells directly by interaction with a functional NF-B site in the IFN- promoter or by activation of p38 MAPK through regulation of GADD45ß in response to IL-18 (27). In our studies, we also observed reduced IFN- production by antigen-specific CD4+ T cells of immunized IL-1R1-/- mice. However, this does not provide a direct explanation for the protection from heart inflammation, because IFN--/- mice develop exacerbated myocarditis (8–10). On the other hand, IL-1 and NF-B activation has also been associated with the development of Th2 responses (28–30), but we found that IL-4 and IL-10 production was unaffected after restimulation of CD4+ T cells from immunized IL-1R1-/- mice excluding immune deviation and the induction of IL-10+ regulatory T cells. Furthermore, Th2 cells do not play a crucial role in autoimmune myocarditis, although they can modulate the disease (8). Regardless whether IL-1 and NF-B regulate IFN- or IL-4 production in CD4+ T cells, our data clearly show that pathogenic CD4+ T cells in the IL-1R1-/- mice were fully activated and induced disease when they encountered IL-1R1+/+ DCs presenting the antigen. A normal Th1 and Th2 subset polarization was also observed when naive IL-1R1-/-CD4+ specific for OVA323–339 were stimulated with cognate antigen in the presence of wild-type DCs (unpublished data).
Transfer of immature BM-DCs from wild-type mice completely restored disease in IL-1R1-/- mice suggesting that DCs lacking the IL-1R1 are incapable to prime CD4+ T cells and induce autoimmunity. It is conceivable that IL-1 acts on DCs by stimulating their capacity to up-regulate CD40L and OX40 on CD4+ T cells (31). DCs might require IL-1R1 triggering for proper development, migration, antigen processing/presentation, or/and for optimal activation. In preliminary experiments, some of these possibilities were addressed. We purified CD11c+ DCs from lymph nodes and spleen of naive mice and analyzed them by flow cytometry. The frequency of CD8+ and CD8- DCs and the expression levels of MHC class II, CD86, and CD40 were comparable in IL-1R1+/+ and IL-1R1-/- mice indicating that DC development was not grossly affected (not shown). Our experiments using BM-DCs suggest that IL-1R1 triggering is required for production of a panel of pro-inflammatory cytokines including IL-12p70, IL-1, IL-6 and TNF-, which are all known to be targets of NF-B (32, 33). Reduced production of these cytokines was also observed when BM-DCs from wild-type mice were stimulated in the presence of neutralizing anti-IL-1ß mAb (). This finding is in keeping with results obtained with human DC subsets (34).
Interestingly, IL-1R1-/- DCs seem not to have a relevant defect to mature upon stimulation, as the up-regulation of CD80, CD86, and ICAM-1, the latter also activated by NF-B, was almost comparable to IL-1R1+/+ DCs.
Nevertheless, we cannot exclude that other DC functions such as their migratory capacity is reduced in the absence of IL-1R1 (35, 36). Regardless, the impaired production of TNF-, IL-6, and IL-12 itself may explain disease resistance of IL-1R1-/-mice, because each of them is indispensable for the induction of autoimmune myocarditis (7, 8, 37).
The phenotype of in vitro–activated IL-1R1-/- DCs appears somewhat reminiscent to the TNF-–induced semimature DCs described by Menges et al. (23), which showed impaired IL-12p70 production but normal up-regulation of costimulatory molecules upon stimulation. These semimature DCs were tolerogenic in a model of CD4+ T cell–mediated autoimmune disease. Despite the fact that injection of immature IL-1R1-/- DCs did not prevent disease in immunized IL-1R1+/+ mice, we cannot exclude a potential tolerogenic role for IL-1R-/- DCs because our experimental setting is different from the published tolerance induction protocol (23).
N. Rose and coworkers had shown that IL-1 treatment renders otherwise resistant mouse strains susceptible to viral myocarditis and suggested an important role for IL-1 and TNF- in up-regulation of adhesion molecules on endothelial cells (18). ICAM-1 expression has been shown to be critical for the recruitment of inflammatory cells in Coxsackie B3–induced myocarditis (38). Our data do not rule out a role for IL-1R1 signaling in endothelia activation or target organ homing of antigen-specific T cells. The fact that reconstitution with IL-1R1-/- DCs alone is sufficient in restoring myocarditis susceptibility and normal expression of endothelia activation markers in reconstituted IL-1R1-/-mice, suggest that IL-1R1–mediated mechanisms are either not decisive in mediating the access of autoreactive CD4+ T cells to the heart or may be compensated by redundant pathways.
Recently, it has been shown that structural proteins of several microorganisms potentially affecting the human heart show homology to the pathogenic -myosin peptide in BALB/c mice and to the human -myosin (39). Our findings contribute to the understanding of how DC activation may be initially modulated by microbial products in the absence of T cells and in the presence of innate signals. Indeed, the initial activation of DCs phagocyting debris and microbes containing potential self-peptide homologues might determine whether a pathogenic autoreactive response evolves or not. In this context, IL-1R1 signaling may play an important role bridging innate and adaptive immunity.
Taken together, our data show that IL-1R1 signaling induces autoimmunity by critically enhancing the capacity of antigen-presenting DCs to prime autoreactive T cells. Given the availability of clinically effective drugs targeting IL-1, our findings open new therapeutic perspectives in the treatment of inflammatory heart disease. Meanwhile, our data are a major step forward in understanding the mechanisms underlying autoimmunity and cardiac inflammation.
| Acknowledgments |
|---|
Submitted: October 9, 2002
Revised: December 11, 2002
Accepted: December 16, 2002
| References |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References
| ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Abstract |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
Key Words: genital mucosa • cytokines • lymph node • epithelium • sexually transmitted disease
| Introduction |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
A mouse model of ivag infection using HSV-2 thymidine kinase (TK) mutant strain (6, 7) has provided important insights into the mechanism of immune resistance to HSV-2. The TK- mutant HSV-2 causes mild vaginal pathologies that resolve within 7 d but do not result in neurologic diseases, making it an ideal virus with which to study immune induction to vaginal HSV-2 infection. Intravaginal infection with TK- HSV-2 is known to induce protective immunity that is primarily mediated by IFN-secreted from CD4+ T cells (8, 9) and HSV-2–specific IgG (10, 11). However, the viral infection events and APC types involved in inducing the T cell responses to HSV-2 are poorly understood. A recent paper has demonstrated that B cells represent the major cell type recruited from the vaginal mucosa to the draining lymph nodes after ivag HSV-2 delivery, suggesting a role for B cells in the immune initiation process (12). In this paper, no migration of LCs from the vagina to the draining lymph nodes was detected, raising the question about whether LCs are involved in antigen presentation and T cell activation in the draining lymph nodes.
To understand the mechanism of immune induction by DCs and other APCs to HSV-2 infection in the vaginal mucosa, we examined the distribution, phenotype, and function of DCs at the sites of infection and in the draining lymph nodes. By following HSV-2 infection and DC distribution by immunofluorescence microscopy, we demonstrate that HSV-2 productively infects the vaginal epithelium exclusively and that submucosal DCs are recruited to the lamina propria bordering the infected epithelium within 24 h after infection (a.i.). In addition, we present the time course of the appearance of DCs harboring HSV-2 peptides in the draining lymph nodes, the induction of HSV-2–specific CD4+ T cell responses in the local draining lymph nodes and the subsequent migration of these primed T cells to systemic lymphoid organs. Furthermore, by isolating specifically the LCs and submucosal DCs from the draining lymph nodes, we demonstrate that the primary cells that migrate from the vaginal mucosa and present viral antigens to CD4+ T cells are non-LC submucosal DCs. The results from this paper provide the first evidence that DCs are recruited rapidly to the lamina propria bordering the infected vaginal epithelial cells infected with HSV-2, and that these CD11c+/CD11b+ submucosal DCs, but not LCs or CD8+ DCs, B cells, or other APCs, phagocytose viral antigens and migrate to local lymph nodes to induce protective Th1 CD4+ T cell responses.
| Materials and Methods |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
Animals and HSV-2 Infection.
6–8-wk-old female BALB/c mice were obtained from the National Cancer Institute. Mice transgenic for TCR that recognizes OVA323–339 peptide in the context of I-Ad (DO11.10TCR-ß transgenic mice) on a BALB/c background were provided by Dr. Dennis Loh (Washington University, St. Louis, MO). The estrous stage of mice was determined from analysis of vaginal smears taken by a calcium-alginate swab ( ) and stained with Diff-Quik Stain (Dade Behring) according to manufacturer's instruction. Stained cells were carefully examined and the estrous stage of each mouse was identified as diestrous, estrous, metestrous-1, or metestrous-2 according to a previously established protocol (15, 16). For virus infection studies, mice were injected subcutaneously in the neck ruff with Depo-Provera® (Pharmacia & Upjohn Diagnostics) at 2 mg/mouse in 100-µl volume 5–7 d before infection, swabbed with calcium-alginate and inoculated ivag with either 107 PFU of HSV-2 strain 186TKKpn or inoculated with noninfected Vero cell lysate (mock infection) in 10 µl volumes using a blunt-ended micropipette tip. All procedures used in this paper complied with federal guidelines and institutional policies by the Yale Animal Care and Use Committee.
Antibodies.
The following antibodies were used for the identification of cell populations: anti-CD11c (N418), anti-CD11b (M1/70), anti-CD8 (53-6.7), anti-DEC205 (NLDC-145), and anti–MHC class II (M5/114). The aforementioned antibodies were purchased from , except for NLDC-145 and N418 which were purified from hybridoma supernatants. The LC-specific anti-gp40 antibody G8.8 developed by Andrew Farr (University of Washington, Seattle, WA), was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa Department of Biological Sciences. For localization of HSV-2–infected cells, polyclonal rabbit antiserum against HSV-2 was purchased from BioGenex.
Double Immunofluorescence Staining of Vaginal Tissues.
To examine the distribution of DC in relation to HSV-2 infection within the vagina, frozen sections of vagina were stained with a variety of antibodies in a procedure similar to that described previously (17) with minor modifications. In brief, 6–8-µm frozen sections were fixed in acetone and blocked with TNB buffer (3% Casein in PBS; ) containing 5% normal donkey serum. To block endogenous biotin, the sections were further treated with the Avidin–Biotin block ( ), and endogenous peroxidase activity was quenched with 1% H2O2. The primary antibody was applied at 5 µg/ml for 1.5 h at room temperature. Slides were washed and incubated with biotin-conjugated donkey F(ab')2 anti–hamster IgG ( , Inc.), followed by incubation with streptavidin–HRP conjugate ( ). The antigens were detected using tyramide-FITC ( Inc.) according to the manufacturer's instructions. After the development with the first antibody, sections were blocked with Avidin–Biotin, followed by incubation with 2% H2O2. The sections were subsequently stained with the second primary antibody in a similar manner as described above in the previous paragraph with proper species-specific secondary antibody. The slides were developed with tyramide-tetramethylrhodamine ( ). At the end of the staining, slides were washed and incubated with DAPI (Molecular Probes) and mounted with Fluoromount-G ( ). The stained slides were analyzed by fluorescence microscopy (Leitz Orthoplan 2) with a 20x objective lens or by confocal microscopy using a confocal laser microscope (model LSM510; Carl Zeiss MicroImaging, Inc.) with a 20 or 40x objective lens with water.
Preparation of Dendritic Cells and Other APCs.
DCs and other APCs were prepared from draining lymph nodes of ivag HSV-2–infected mice as described previously (18). In brief, draining lymph nodes (inguinal and iliac), or in some cases spleen and mesenteric lymph nodes, were excised from infected mice at various time points. Lymph nodes were digested with collagenase D and DNase I and incubated in the presence of 5 mM EDTA at 37°C for 5 min. A single-cell suspension was prepared, and cells were incubated with anti–mouse CD11c-coated magnetic beads (Miltenyi Biotech) and selected on MACS separation columns twice. Positively selected cells were routinely 80–90% DC based on CD11c and MHC class II staining by flow cytometry. For CD11c-depleted B cells and MHC class II+ cells, CD11c+ cells were depleted from the draining lymph node suspension by labeling CD11c+ cells with the MACS separation beads (anti-CD11c–coated beads) followed by selection using the LD depletion column (Miltenyi Biotech). B220+ or I-Ad+ cells were obtained from CD11c-depleted population by staining with FITC-conjugated B220 or FITC-conjugated anti–MHC class II antibody and selected on anti-FITC–conjugated MACS beads according to the manufacturer's instructions (Miltenyi Biotech). The B220+- and I-Ad+–selected cells were routinely 80–90% pure as determined by FACS® (see a). To prepare activated DCs for experiments described in e, transiently adherent DCs were prepared from splenocytes of BALB/c mice as described previously (19). For FACS® sorting of LCs and submucosal DCs, CD11c-enriched cells from the draining lymph nodes were stained with anti-gp40 (rat IgG2a) followed by FITC-conjugated anti–rat Fab ( ). Cells were washed extensively and stained with anti-CD11b and anti-CD11c. The submucosal DCs (CD11b+/gp40-/CD11c+) and LCs (CD11c+/gp40+) were sorted to 99% purity. In separate experiments, CD8+ and CD11b+ DCs were isolated from the draining lymph nodes after staining of CD11c-enriched population with antibodies to CD8, CD11b, and CD11c. The CD8+ DCs (CD8+/CD11c+/CD11b-) and CD11b+ DCs (CD11b+/CD11c+/CD8-) were FACS®-sorted to 99% purity.
|
|
Stimulation of HSV-2–specific CD4+ T Cells by DCs and Other APCs.
To determine the ability of the DCs to stimulate HSV-2–specific T cells, 105 CD4+ T cells from draining lymph nodes of mice infected ivag with 186TKKpn 5 d before were co-cultured with 105 APCs in the presence of the heat-inactivated virus or heat-inactivated nonvirus-infected cell lysate control. Virus-infected (186TKKpn) or uninfected Vero cell control lysate was heat-inactivated at 56°C for 30 min, at which point they were determined noninfectious as assayed by addition to susceptible Vero cells (unpublished data). No difference in proliferation or cytokine secretion was detected between wells that received heat-inactivated cell lysate and those that received media alone (unpublished data). T cells were stimulated for 72 h in vitro by various APCs and the supernatant was tested for cytokines by ELISA as described previously (18). To determine the source of cytokines in the co-culture, T cells or APCs, in some experiments, were inactivated by irradiation at 3,000 rad.
Detection of Viral DNA in Purified DCs.
Total DNA from purified DCs or from infected vaginal epithelium was obtained by resuspending the cell pellet in STE buffer (0.1 M NaCl, 10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and boiling for 10 min. HSV-2 glycoprotein B gene–specific primers HSV2a-1 (forward, 5' CTGGTCAGCTTTCGGTACGA 3') and HSV2a-2 (reverse, 5' CAGGTCGTGCAGCTGGTTGC 3') were used to amplify viral DNA as described previously (20). The presence of genomic DNA was determined by PCR amplification of housekeeping gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) using primers (forward, 5'CTGGAGGCAGGAAGGAGTCC 3'; reverse, 5' GGTCCTCCTACGTTGTCTGG 3') and amplifying for 35 cycles. The lower limit of detection using our PCR protocol was calculated by performing PCR on purified viral DNA as follows. Cell-free 186TKKpn HSV-2 virions propagated in Vero cells were collected from the culture supernatant by centrifugation at 20,000 g at 15°C (rotor SW27; ) for 45 min. The pellet containing cell-free virions was collected, and viral genomic DNA was purified using QIAamp DNA Mini Kit ( ). Eight 10-fold dilutions of DNA were made, and 1 µl of each dilution was used as a template to amplify viral DNA using the HSV2a-1 and HSV2a-2 primers as described above in the previous paragraph. The lower limit of detection by our PCR protocol was 30 viral particles per reaction. Similarly, by isolating total DNA from in vitro–infected Vero cells, our PCR protocol was able to consistently detect as little as one infected cell per reaction.
Real-time PCR Analysis.
TaqMan Real-time PCR amplification and detection were performed using a sequence detector (model ABI 7700; PE Biosystems). HSV-2 TK gene-specific primers (F145, 5' CTGTTCTTTTATTGCCGTCATCG 3' and R263, 5' GTCCATCGCCGAGTACGC 3') and a fluorescence-labeled probe (5' Fam-TTTGAACTAAACTCCCCCCACCTCGC-Tamra 3') were used to detect HSV-2 viral DNA. Reactions were performed in 50-µl volumes containing TaqMan Universal PCR Master Mix (PE Biosystems) with a final concentration of 250 nM of each primer and 200 nM of TaqMan probe, and reactions were amplified for 40 cycles. 104 cell equivalent amount of DNA samples extracted from draining lymph node DCs were run in parallel with duplicated viral DNA standards to determine the quantity of viral DNA molecules. For viral DNA standards, purified HSV-2 viral DNA was serially diluted in the presence of 30 ng genomic DNA of uninfected CV-1 cells. The viral DNA was diluted such that 1 µl of the sample contained 106, 105, 104, 103, 102, 10, and 100 of HSV-2 DNA. As little as two viral DNA copies could be routinely detected in these assays.
| Results |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
|
|
Although cytokines were not detected from the CD4+ T cells in noninfected mice stimulated with DCs from infected mice, it was possible that the cytokine secretion observed in the DC–T cell co-culture in (b–d) reflected nonspecific stimulation of in vivo–primed T cells by the activated DCs in the draining lymph nodes. To address these possibilities, we performed two sets of experiments. First, to determine whether the draining lymph node T cells secreted cytokines in a nonantigen-specific manner, CD4+ T cells from mice infected for 4 d with HSV-2 were co-cultured with in vitro–stimulated transiently adherent splenic DCs. In the absence of viral antigen, even though the transiently adherent overnight-stimulated DCs were fully activated, they were not able to induce secretion of cytokines from the draining lymph node CD4+ T cells ( e). Thus, the draining lymph node CD4+ T cells require recognition of viral antigens for activation and secretion of cytokines. Second, to determine whether the DCs in the draining lymph nodes stimulated T cells nonspecifically, CD4+ T cells from DO11.10 mice were preactivated in vitro in the presence of OVA323–339 peptide. These maximally activated clonal T cells were coincubated with draining lymph node DCs from day 3 HSV-2–infected mice in the presence or absence of the OVA peptide. Although activated DO11.10 T cells secreted large amounts of cytokines in the presence of the specific peptide, day 3 a.i. draining lymph node DCs were not able to induce cytokine secretion in the absence of the antigenic peptide ( f). Thus, cytokine secretion in the DC–T cell co-culture requires the presence of specific viral antigens, and the mere activation status of the CD4+ T cells, DCs, or both in combination, does not account for the cytokines observed in the co-culture.
Dendritic Cells Are the Primary APCs in IFN Induction from CD4+ T Cells.
In an effort to examine the relative contribution of different APC populations in T cell priming during ivag HSV-2 infection, we isolated both the CD11c+ and CD11c- fractions of the draining lymph node cells from mice infected ivag 5 d before. This time point was chosen based on the ability of the draining lymph node DCs between days 2 and 5 a.i. to optimally stimulate T cells in vitro as shown in . The CD11c-depleted population was further divided into B220+/CD11c- and I-Ad+/CD11c- groups ( a). The two populations of DCs (MHC class IImed vs. MHC class IIhi cells) were present in the lymph nodes as described previously (22). When HSV-2–specific CD4+ T cells isolated from day 5 draining lymph nodes of HSV-2–infected mice were co-cultured with these APC populations, remarkably, only T cells stimulated with CD11c+ DC population secreted high levels of cytokines, whereas those stimulated with CD11c-depleted lymph node APCs or with B cells had minimal IFN and IL-10 secretion (). The lack of T cell stimulation by CD11c- APCs was not due to their inherent inability to present antigen on MHC class II molecules because all APCs stimulated strong cytokine secretion from HSV-2–specific T cells when exogenous viral antigens were provided in vitro (). Together, during HSV-2 infection, CD11c+ DCs represent the primary APCs in stimulating IFN secretion from viral antigen-specific T cells in the draining lymph nodes.
Dendritic Cells Acquire HSV-2 Antigens in the Absence of Direct Infection.
The draining lymph node DCs could have acquired the viral antigen either by phagocytosis of infected epithelium or by direct HSV-2 infection. To our surprise, no evidence of DC infection was detected by examination of viral protein by immunofluorescence staining () or by detection of viral DNA by PCR () . The lower limit of detection was 30 cell-free viral particles or one infected Vero cell per reaction using our PCR protocol (Materials and Methods). To rule out the possibility of a very low number of HSV-2 viral replication within DCs, a more sensitive method of detection of viral DNA was used. 104 cell equivalents of total DNA from draining lymph node DCs at days 1–3 a.i. were subjected to Real-time PCR. Despite our ability to consistently detect as little as two viral DNA copies per reaction, and that approximately one million viral DNA copies were detected from vaginal epithelial layers from the same mouse, none of the DNA samples isolated from the draining lymph node DCs had demonstrable viral DNA ( b). Moreover, no viral DNA was detected from total lymph node cell suspension ( b), indicating that viral replication is strictly confined to the vaginal epithelial cells and that virus does not travel to the draining lymph nodes.
|
|
|
| Discussion |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References |
|---|
The current paradigm of immune induction to infectious agents at body surfaces covered by squamous epithelium such as the skin and the vagina is that LCs encounter pathogens within the epithelium, take up antigens from the pathogens, and migrate to the draining lymph nodes to prime naive T cells (29). In our current work, the rampant HSV-2 infection of the vaginal epithelium resulted in the complete lysis of the cells in this layer, destroying LCs in this tissue within 48 h a.i. However, rapid recruitment of submucosal CD11c+ DCs just beneath the infected epithelium was observed within 24 h a.i., followed by a subsequent appearance of CD11c+/CD11b+ DCs presenting the viral peptides in the draining lymph nodes by 48 h a.i. To decipher the relative roles of LCs and submucosal DCs in antigen presentation and T cell activation in the draining lymph nodes, LCs and submucosal DCs were isolated by FACS® from draining lymph nodes after HSV-2 infection. Stimulation of HSV-2–specific T cells revealed that only the submucosal DCs, and not LCs, presented viral antigens to CD4+ T cells (). Our observations that submucosal DCs, but not LCs, are the primary cells responsible for T cell priming in the draining lymph nodes after ivag HSV-2 infection are also supported in a paper by Parr et al., which tracked the emigrant cells from vaginal epithelium with a fluorescent dye (12). With this method, no migration of the LCs from the vaginal epithelium to the draining iliac lymph nodes was observed after ivag HSV-2 infection (12). Furthermore, we examined the antigen-presenting capacity of the CD8+ lymph node DCs that have been shown to be responsible for presenting cell-associated antigens to T cells in vivo (26–28). Comparison of the ability of the two major subsets of DCs in the draining lymph nodes clearly demonstrates that only the CD11b+ DCs, but not CD8+ DCs, present in vivo–derived viral peptides to CD4+ T cells (). These results indicate that the viral antigens are presented directly by the CD11b+ DCs in the absence of either antigen transfer to the lymph node CD8+ DC or the differentiation of these cells to the CD8+ phenotype. Together, our data demonstrate a previously unrevealed role of the submucosal DCs in antigen presentation to CD4+ T cell after ivag HSV-2 infection, and further provide evidence for the lack of participation by LCs and the CD8+ DCs in this process.
Several studies have examined the consequences of direct infection of DCs by HSV-1 in vitro. Human DCs have been shown to express some of the receptors required to mediate the entry of HSV such as Hve-A and Hve-B and can be infected by HSV-1 in vitro (30, 31). HSV-1 infection was shown to inhibit maturation of immature DCs (30, 31) and their ability to prime naive T cells (31). Our in vivo examination with TK- HSV-2 revealed that the infection was not detected within the emigrant DC populations in the draining lymph nodes, despite the proximity of recruited submucosal DCs to the infected epithelium. In fact, the draining lymph nodes did not contain any viral DNA. Our finding is consistent with the paper by Mueller et al., which demonstrates that despite rapid activation of CD8+ T cells after footpad HSV-1 infection, the draining lymph nodes contained no viral DNA (32). The difference in the infectivity of human blood DCs to HSV-1 in vitro and mouse genital submucosal DCs to HSV-2 in vivo may be explained by a number of factors, including the difference in expression of Hves (unpublished data) and the fact that murine Hve-B does not function as a viral entry mediator for HSV (33). Productive replication of HSV-2 was strictly confined to the epithelial layer, within which LCs reside. Thus, our data suggest that LCs may be inhibited from performing antigen-presenting functions as a result of the lytic destruction of the epithelial layer. This hypothesis is supported by the progressive reduction of the number of LCs in draining lymph nodes after HSV-2 infection ( a). Conversely, we show that HSV-2 infection of the epithelium did not lead to suppression, but instead to activation of the phenotype and function of the neighboring uninfected submucosal DCs. The factors released by the HSV-infected epithelial cells, or the virus itself, are likely responsible for inducing activation of the submucosal DCs.
A clear picture of immune inductive events after ivag HSV-2 infection emerges from our work. Upon entry into vaginal lumen, HSV-2 specifically infects the diestrous vaginal epithelium. This infection event results in the recruitment of submucosal DCs toward the infected epithelium, presumably from both local lamina propria and peripheral sources. After recruitment, the foci of DCs directly beneath the infected epithelium form within 24 h and DCs continue to accumulate for several days. This event in the vaginal mucosa is accompanied by the appearance of DCs that harbor HSV-2 peptide on their cell surface MHC class II capable of stimulating HSV-2–specific T cells in the draining lymph nodes. The DCs that migrate to the draining lymph nodes during the first 2–3 d a.i. express higher levels of costimulatory molecules, and are thus capable of stimulating antigen-specific T cells. Lagging 1 d behind, CD4+ T cells capable of secreting high levels of IFN and moderate levels of IL-10 in an HSV-2–specific manner begin to become detectable in the draining lymph nodes first, and subsequently in the spleen. The HSV-2–specific Th1 cells found in the spleen likely migrated from the priming lymph nodes because we detected no evidence of antigen-presenting DCs in the spleen or in any other nondraining lymph nodes at any time points examined. To our surprise, despite the fact that numerous CD4+ T cells were present in the draining lymph nodes at 14 d a.i., we did not detect cytokine secretion from CD4+ T cells by this time point. Furthermore, HSV-2–specific CD4+ T cells were not found in the spleen at this time. It is possible that regulatory T cells develop in these tissues that prohibit secretion of cytokines from effector Th1 cells. Alternatively, the HSV-2–specific effector memory T cells may have migrated to nonlymphoid tissues as described for lymphocytic choriomeningitis virus (34). In support of the latter possibility, despite our inability to detect effector T cells in the lymphoid tissues after 14 d a.i., these cells are clearly present and are recruited rapidly to the sites of infection and mediate protective immunity during secondary viral challenges (8, 9).
Our data provide the first evidence of the critical role played by the submucosal vaginal DCs in eliciting IFN-mediated CD4+ T cell responses during ivag HSV-2 infection. Because the expression of receptors and adhesion molecules for various sexually transmitted pathogens may differ significantly between the submucosal DCs and LCs of the vaginal mucosa (35), our results suggest the importance of the involvement of the submucosal vaginal DC populations in disease pathogenesis and in immune induction to other microbial agents of sexually transmitted diseases.
| Acknowledgments |
|---|
A. Iwasaki was supported by a Burroughs Wellcome Fund Career Award in Biomedical Sciences. D.M. Knipe was supported by the National Institutes of Health grants P01NS35138 and AI42257.
Submitted: July 2, 2002
Revised: November 7, 2002
Accepted: November 7, 2002
| References |
|---|
| Top Abstract Introduction Materials and Methods Results Discussion References
|
|---|