主题:Cassette

+ 关注 ≡ 收起全部文章
336*280_ads

Hepatic ATP-Binding Cassette Transporter A1 Is a Key Molecule in High-Density Lipoprotein Cholesteryl Ester Metabolism in Mice

【摘要】  Objective- Mutations in ATP-binding cassette transporter A1 (ABCA1), the cellular lipid transport molecule mutated in Tangier disease, result in the rapid turnover of high-density lipoprotein (HDL)-associated apolipoproteins that presumably are cleared by the kidneys. However, the role of ABCA1 in the liver for HDL apolipoprotein and cholesteryl ester (CE) catabolism in vivo is unknown.

Methods and Results- Murine HDL was radiolabeled with 125 I in its apolipoprotein and with [ 3 H]cholesteryl oleyl ether in its CE moiety. HDL protein and lipid metabolism in plasma and HDL uptake by tissues were investigated in ABCA1-overexpressing bacterial artificial chromosome (BAC)-transgenic (BAC + ) mice and in mice harboring deletions of total (ABCA1 -/- ) and liver-specific ABCA1 (ABCA1 -L/-L ). In BAC + mice with elevated ABCA1 expression, fractional catabolic rates (FCRs) of both the protein and the lipid tracer were significantly decreased in plasma and in the liver, yielding a diminished hepatic selective CE uptake from HDL. In contrast, ABCA1 -/- or ABCA1 -L/-L mice had significantly increased plasma and liver FCRs for both HDL tracers. An ABCA1 deficiency was associated with increased selective HDL CE uptake by the liver under all experimental conditions.

Conclusions- Hepatic ABCA1 has a critical role for HDL catabolism in plasma and for HDL selective CE uptake by the liver.

The role of ABCA1 in HDL metabolism was investigated with doubly radiolabeled HDL. In mice with transgenic expression of ABCA1 or in mice with deletions of this transport protein, it is shown that ABCA1 has a substantial effect on HDL turnover in plasma and on HDL catabolism by the liver.

【关键词】  ABCA HDL selective uptake cholesteryl ester


Introduction


ATP-binding cassette transporter A1 (ABCA1), a cellular lipid transport molecule mutated in Tangier disease (TD) patients, is essential for the maintenance of plasma high-density lipoprotein (HDL) cholesterol levels. 1 Studies on the role of ABCA1 in the generation of HDL particles indicate that the ABCA1 pathway is a major source for HDL biogenesis. 2


ABCA1 is widely expressed in mammalian tissues and is most abundant in the liver, adrenal, and testis of mice. 2,3 The contribution of ABCA1 in specific tissues to HDL formation has recently been a focus of investigation. Overexpression of adenovirally delivered ABCA1 in the liver of wild-type (WT) mice yields a significant increase in plasma HDL cholesterol (HDL-C). 4 In contrast, mice with ABCA1 selectively deleted in the liver show an 80% decrease in plasma HDL-C. 5 These investigations suggest that the liver is the major site of ABCA1-mediated lipidation of lipid-free apolipoprotein A-I (apoA-I), the dominant protein component of HDL. Presumably, this process yields mature HDL particles.


Whether ABCA1 plays a role in HDL catabolism has not been comprehensively investigated. ABCA1 may facilitate the lipidation and conversion of small HDL particles into large spherical HDL, thus slowing down the catabolism of plasma HDL, prolonging its residence time in the circulation, and contributing to the maintenance or raising of plasma HDL. 5 In patients with mutations in the ABCA1 gene, intravenously injected apoA-I is rapidly cleared, suggesting a role for ABCA1 in the catabolism of HDL-associated apolipoproteins. 6,7 Such a rapid clearance of HDL apoA-I has also been observed in the Wisconsin hypoalpha mutant chicken, a naturally occurring model with mutations in the ABCA1 gene. 8 Besides, a recent study showed that the catabolism of HDL apoA-I was higher in liver-specific ABCA1 knockout (ABCA1 -L/-L ) mice compared with controls. 5 This apoA-I hypercatabolism presumably is mediated by the kidneys, whereas no major change in liver catabolism of apoA-I was observed. However, in these studies, only the apolipoprotein component of HDL was radiolabeled. 5-8 Therefore no information is available about the fate of cholesterol associated with HDL. It is established that HDL protein and cholesteryl ester (CE) moieties are metabolized at different rates in vivo. 9 In addition, although catabolism by liver and kidneys were addressed in some studies, 5 the role of ABCA1 in HDL metabolism of other organs has not been investigated.


In this study, the function of ABCA1 in plasma metabolism of 2 major components of the HDL particle (ie, apolipoproteins and CE) was addressed. Besides, the role of ABCA1 in HDL uptake by tissues and in particular by the liver was investigated. It is shown that ABCA1 is essential for the catabolism of HDL-associated apolipoproteins and lipids and for the selective uptake of HDL-associated CE, in particular by the liver.


Methods


For Methods, please see the online supplement, available at http://atvb.ahajournals.org.


Results


Supplemental Figures I, II, III, and IV are available online at http://atvb.ahajournals.org


Plasma Cholesterol in Mice With Overexpression of ABCA1


To investigate the role of ABCA1 in HDL metabolism, ABCA1-bacterial artificial chromosome (BAC)-transgenic (BAC + ) mice were used that express ABCA1 in the liver and in other tissues. 10,11 BAC + animals showed an increase in plasma total cholesterol (T-C; P =0.002; n=6) and HDL-C compared with WT littermate controls ( Table ).


Plasma T-C and HDL-C in the Experimental Mouse Lines


Because untreated BAC + mice had quantitatively only a mild increase in ABCA1 protein expression (supplemental Figure I) and in plasma HDL-C ( Table ), these animals were fed the liver X receptor (LXR) agonist T0901317 to increase ABCA1 and HDL-C. 11 Feeding this compound to BAC + mice further increased ABCA1 protein expression (supplemental Figure I). The LXR agonist yielded an additional and significant increase in plasma T-C of 69% ( P <0.0001; n=7) and in HDL-C of 81% ( P <0.0001; n=7) compared with WT controls ( Table ).


Because LXR agonists regulate many genes in lipid metabolism, 12 ABCA1 -/- mice were fed T0901317 to determine whether the increase in HDL-C observed in the presence of the compound was mediated through ABCA1. Indeed, no change in plasma HDL-C was observed in treated ABCA1 -/- mice ( Table ). This result indicates that ABCA1 is responsible for HDL-C elevation in response to LXR agonist treatment.


HDL Catabolism in Plasma in Mice With Overexpression of ABCA1


After injection of 125 I-TC-/[ 3 H]CEt-HDL, the catabolism of this preparation was investigated in WT, BAC +, and BAC + mice fed the LXR agonist. 13 The plasma fractional catabolic rates (FCRs) for both HDL tracers were decreased in BAC + mice compared with WT ( Figure 1 A). This decrease was not statistically significant, presumably because of the low levels of ABCA1 transgene expression in BAC + mice. However, a significant decrease in plasma FCRs was observed in the LXR agonist-treated BAC + mice ( 125 I: WT, 68.9±5.7 versus LXR agonist-fed BAC +, 51.2±5.2 pools x 10 3 x h -1, n=7, P =0.0001; [ 3 H]CEt: WT, 157.1±13.5 versus LXR agonist-fed BAC +, 118.2±11.9 pools x 10 3 x h -1, n=7, P =0.0001; Figure 1 A). If the difference in plasma FCRs is calculated ([ 3 H]CEt- 125 I-TC), then selective CE uptake from plasma HDL by all tissues of a mouse is obtained. 9 This selective CE removal decreased in BAC + mice and was further reduced in the LXR agonist-fed BAC + animals compared with WT (WT, 88.3±14.7 and LXR agonist-fed BAC +, 67.0±13.0; n=7; P =0.007). Thus, increasing ABCA1 expression decreased the selective CE removal from HDL and delayed plasma HDL turnover.


Figure 1. Plasma decay and uptake of 125 I-TC-/[ 3 H]CEt-HDL by tissues in WT and BAC + mice. 125 I-TC-/[ 3 H]CEt-HDL was injected into WT, BAC +, or BAC + mice fed the LXR agonist. Blood was harvested periodically for 24 hours, and tissues were finally collected. Plasma and tissue samples were analyzed for both HDL tracers. Plasma (A), liver (B), adrenal (C), and kidney (D) FCRs for 125 I-TC ( 125 I) and [ 3 H]CEt ( 3 H) and selective HDL CE uptake ( 3 H- 125 I) were calculated. Values are means±SD. n=6 mice per group.


HDL Uptake by Tissues in Mice With Overexpression of ABCA1


Tissue uptake of 125 I-TC-/[ 3 H]CEt-HDL was explored 24 hours after injection in mice. 9,13 Liver, adrenals, and kidneys showed the major changes in HDL tracer internalization in these experiments ( Figure 1 ). Remarkably, these tissues have high levels of ABCA1 expression. 2


The liver is the principal site of HDL catabolism in rodents, and this is confirmed here ( Figure 1 B). 9 In this organ, the uptake of both HDL-associated tracers decreased in BAC + mice ( 125 I: WT, 28.8±4.0 versus BAC +, 25.9±1.5 pools x 10 3 x h -1, n=5, P =NS; [ 3 H]CEt: WT, 114.9±21.2 versus BAC +, 100.5±11.4 pools x 10 3 x h -1, n=6, P =NS). This decrease in hepatic HDL tracer uptake was significantly different in LXR agonist-treated BAC + mice ( 125 I: WT, 28.8±4.0 versus LXR agonist-fed BAC +, 20.9±1.9 pools x 10 3 x h -1, n=6, P =0.00005; [ 3 H]CEt: WT, 114.9±21.2 versus LXR agonist-fed BAC +, 78.3±14.0 pools x 10 3 x h -1, n=6, P =0.0009). Hepatic HDL selective CE uptake (ie, the difference between [ 3 H]CEt and 125 I-TC) decreased in BAC + mice (WT, 86.1±21.5; BAC +, 74.5±11.5; P =NS) and was significantly lower in LXR agonist-treated BAC + animals (WT, 86.1±21.5; LXR agonist-fed BAC +, 57.4±14.2; P =0.01; Figure 1 B). As expected, quantitatively, the highest rates of HDL tracer uptake from all tissues investigated were observed in the liver.


In adrenals, a trend toward a decrease in FCR for [ 3 H]CEt in BAC + mice ( Figure 1 C) was observed. However, neither the adrenal FCRs for [ 3 H]CEt or 125 I-TC nor HDL CE selective uptake were significantly different in BAC + mice compared with WT, even when BAC + mice were fed the LXR agonist.


In the kidneys, ABCA1 overexpression decreased the uptake of both tracers ( Figure 1 D). The most dramatic fall in renal 125 I-TC organ-FCR was detected in the LXR agonist-treated BAC + mice. The renal uptake rates for 125 I-TC were substantially higher than those for [ 3 H]CEt, and this observation is consistent with a role of the kidneys in HDL apolipoprotein catabolism. 14


HDL uptake by brain, heart, lungs, spleen, stomach, intestine, and carcass was also explored (data not shown). Organ FCRs for both HDL tracers of these tissues were not significantly changed in BAC + and in BAC + mice fed the LXR agonist compared with WT littermates.


HDL Catabolism in Plasma in Mice With Total Deficiency of ABCA1


Because ABCA1 overexpression decreased HDL catabolism, it was hypothesized in analogy to TD patients 6 that in mice, the HDL decay is increased in the absence of ABCA1. To address this question, mice with an induced deficiency of ABCA1 (ABCA1 -/- ) were used. 15 ABCA1 -/- mice harboring the human ABCA1 BAC (BAC + ABCA1 -/- ) were included in this study because any ABCA1-mediated differences in HDL catabolism between ABCA1 -/- and WT mice should be reversed when ABCA1 is re-expressed. 11 Plasma T-C and HDL-C of these animals are presented in the Table.


The complete absence of ABCA1 resulted in a large increase in plasma FCRs of both HDL tracers when compared with WT ( 125 I: WT, 81.5±11.6 versus ABCA1 -/-, 355.0±71.0 pools x 10 3 x h -1, n=6, P =0.0002; [ 3 H]CEt: WT, 177.8±74.9 versus ABCA1 -/-, 1273.9±203.5 pools x 10 3 x h -1, n=6, P =0.00001; Figure 2 A). Selective CE removal from HDL was increased in ABCA1 -/- mice (WT, 96.3±36.7 versus ABCA1 -/-; 918.9±215.6; n=6; P <0.0001; Figure 2 A). When rescued by BAC + ABCA1 -/-, the plasma FCRs for both HDL tracers were significantly decreased to near those of WT mice ( 125 I: ABCA1 -/-, 355.0±71.0 versus BAC + ABCA1 -/-, 140.3±93.1 pools x 10 3 x h -1, n=6, P <0.0001; [ 3 H]CEt: ABCA1 -/-, 1273.9±203.5 versus BAC + ABCA1 -/-, 411.5±293.8 pools x 10 3 x h -1, n=6, P <0.0001), as were the rates of selective CE uptake from HDL (ABCA1 -/-, 918.9±215.6 versus BAC + ABCA1 -/-, 278.2±308.2; n=6; P =0.0009). Thus, plasma HDL catabolism and HDL-selective CE uptake by all tissues of the mice are increased in the absence of ABCA1, and this effect is reversed on ABCA1 expression.


Figure 2. Plasma decay and uptake of 125 I-TC-/[ 3 H]CEt-HDL by tissues in WT, BAC +, ABCA1 -/-, and BAC + ABCA1 -/- mice. 125 I-TC-/[ 3 H]CEt-HDL was injected in WT, BAC +, ABCA1 -/-, and BAC + ABCA1 -/- mice. Blood was harvested periodically for 24 hours, and tissues were finally collected. Plasma and tissue samples were analyzed for both HDL tracers. Plasma (A), liver (B), adrenal (C), and kidney (D) FCRs for 125 I-TC ( 125 I) and [ 3 H]CEt ( 3 H) and selective HDL CE uptake ( 3 H- 125 I) were calculated. Values are means±SD. n=6 mice per group.


HDL Uptake by Tissues in Mice With Total Deficiency of ABCA1


HDL uptake by the liver of ABCA1 -/- mice revealed that the hepatic FCRs for both HDL tracers increased significantly in these animals compared with WT ( 125 I: WT, 28.8±4.0 versus ABCA1 -/-, 178.7±42.7 pools x 10 3 x h -1, n=6, P <0.0001; [ 3 H]CEt: WT, 114.9±21.2 versus ABCA1 -/-, 957.5±167.1 pools x 10 3 x h -1, n=6, P <0.0001; Figure 2 B). This stimulation yielded a substantial rise in selective CE uptake in ABCA1 -/- mice (WT, 86.1±21.5, n=6, versus ABCA1 -/-, 778.8±172.5, n=6; P <0.0001). This increase in HDL-selective CE uptake by the liver of ABCA1 -/- mice was reduced in the BAC + ABCA1 -/- animals (ABCA1 -/-, 778.8±172.5 versus BAC + ABCA1 -/-, 260.5±198.2; n=6; P =0.0003).


In adrenals from ABCA1 -/- mice, the FCRs for both HDL tracers increased significantly ( P <0.0001), and this was in particular true for [ 3 H]CEt ( Figure 2 C). In ABCA1 -/- adrenals, selective HDL CE uptake increased significantly ( P <0.0001) but was decreased to the WT range in this steroidogenic gland from BAC + ABCA1 -/- mice.


In kidneys, an ABCA1 deficiency was associated with a significant ( P <0.0001) increase in the FCR for 125 I-TC ( Figure 2 D). However, this uptake was normalized close to WT in BAC + ABCA1 -/- mice. The renal organ FCRs for [ 3 H]CEt were quantitatively similar in all experimental groups. Thus, in the kidneys, the increase in HDL apolipoprotein uptake was a prominent change in ABCA1 -/- mice. However, comparing quantitatively HDL tracer uptake between liver and kidneys, the liver was the dominant organ site for HDL catabolism under any experimental conditions ( Figure 2 ).


In ABCA1 -/- mice, the ABCA1 deficiency had no impact on HDL catabolism by brain, heart, lungs, spleen, stomach, intestine, and carcass (data not shown).


HDL Catabolism in Plasma in Mice With Liver-Specific Deficiency of ABCA1


To address the role of hepatic ABCA1 in HDL metabolism in more detail, liver-specific ABCA1 knockout (ABCA1 -L/-L ) mice were used. 5 These animals show a substantial ( P =0.0002) decrease in plasma HDL-C compared with WT ( Table ).


ABCA1 -L/-L mice had significantly increased plasma FCRs for both HDL tracers ( 125 I: WT, 73.9±14.0 versus ABCA1 -L/-L, 125.7±55.9 pools x 10 3 x h -1, n=6, P =0.03; [ 3 H]CEt: WT, 125.6±33.2 versus ABCA1 -L/-L, 339.7±145.4 pools x 10 3 x h -1, n=6, P =0.003; Figure 3 A). Besides, selective CE removal from HDL by tissues increased in ABCA1 -L/-L rodents (WT, 51.7±36.0 versus ABCA1 -L/-L, 214.0±155.9; n=6; P =0.02).


Figure 3. Plasma decay and uptake of 125 I-TC-/[ 3 H]CEt-HDL by tissues in WT and ABCA1 -L/-L mice. 125 I-TC-/[ 3 H]CEt-HDL was injected in WT and ABCA -L/-L mice. Blood was harvested periodically for 24 hours, and tissues were finally collected. Plasma and tissue samples were analyzed for both HDL tracers. Plasma (A), liver (B), adrenal (C), and kidney (D) FCRs for 125 I-TC ( 125 I) and [ 3 H]CEt ( 3 H) and selective HDL CE ( 3 H- 125 I) uptake were calculated. Values are means±SD. n=6 mice per group.


HDL Uptake by Tissues in Mice With Liver-Specific Deficiency of ABCA1


The hepatic organ FCRs for both HDL tracers increased significantly in ABCA1 -L/-L mice compared with WT controls ( 125 I: WT, 21.0±4.7 versus ABCA1 -L/-L, 46.4±24.2 pools x 10 3 x h -1, n=6, P =0.02; [ 3 H]CEt: WT, 77.6±19.7 versus ABCA1 -L/-L, 232.9±119.1 pools x 10 3 x h -1, n=6, P =0.006; Figure 3 B). Selective CE uptake was also higher in the liver of ABCA1 -L/-L mice (WT, 56.6±20.2 versus ABCA1 -L/-L, 186.5±121.6; n=6; P =0.02).


In ABCA1 -L/-L mice, the adrenal FCRs for 125 I-TC-/[ 3 H]CEt-HDL were substantially higher compared with WT ( 125 I: WT, 0.11±0.04 versus ABCA1 -L/-L, 0.42±0.22 pools x 10 3 x h -1, n=6, P =0.003; [ 3 H]CEt: WT, 0.74±0.26 versus ABCA1 -L/-L, 7.2±3.7 pools x 10 3 x h -1, n=6, P =0.0003; Figure 3 C). In addition, selective HDL CE uptake increased in adrenals from ABCA1 -L/-L mice (WT, 0.63±0.26 versus ABCA1 -L/-L, 6.76±3.28; n=6; P =0.0005).


In kidneys from ABCA1 -L/-L animals, the FCRs for HDL-associated 125 I-TC increased substantially, whereas the rate for [ 3 H]CEt was quantitatively elevated to a smaller extent ( 125 I: WT, 5.27±1.21 versus ABCA1 -L/-L, 15.74±7.87 pools x 10 3 x h -1, n=6, P =0.005; [ 3 H]CEt: WT, 0.64±0.16 versus ABCA1 -L/-L, 1.39±0.31 pools x 10 3 x h -1, n=6, P =0.0002; Figure 3 D).


The liver-specific ABCA1 deficiency had no substantial effect on HDL tracer uptake by brain, heart, lungs, spleen, stomach, intestine, or carcass (data not shown).


HDL Catabolism in Mice With Adenovirus-Mediated ABCA1 Expression in the Liver


To address the role of hepatic ABCA1 for HDL metabolism, ABCA1 was delivered by adenovirus (Ad-ABCA1) to ABCA1 -/- (supplemental Figure II) and to ABCA1 -L/-L (supplemental Figure III) mice. 4 After Ad-ABCA1 injection, plasma T-C and HDL-C of ABCA1 -/- and ABCA1 -L/-L mice significantly increased (ABCA1 -/- : T-C=9.3±4.8, HDL-C=3.9±1.3 and Ad-ABCA1-treated ABCA1 -/- : T-C=39.8±11.6, HDL-C=19.2±4.3, mg/dL, n=6; (ABCA1 -L/-L : T-C=10.3±4.8, HDL-C=6.5±2.4 and Ad-ABCA1-treated ABCA1 -L/-L : T-C=51.7±5.3, HDL-C=38.3±1.3 mg/dL, n=6). In contrast, no change in plasma cholesterol was observed in mice injected with the control adenovirus.


125 I-TC-/[ 3 H]CEt-HDL metabolism was investigated in ABCA1 -/- and ABCA1 -L/-L mice injected with the control virus or with Ad-ABCA1 (supplemental Figures II and III). For comparison, WT mice were included in these studies. In both groups of ABCA1-deficient mice, ABCA1 expression decreased the plasma FCRs for 125 I-TC and [ 3 H]CEt significantly ( P <0.001). Similarly, selective CE removal from HDL ([ 3 H]CEt- 125 I-TC) by all tissues decreased significantly ( P <0.05) because of Ad-ABCA1 injection.


125 I-TC-/[ 3 H]CEt-HDL uptake by the liver was investigated in ABCA1 -/- and ABCA1 -L/-L mice injected with Ad-ABCA1 or with the control virus (supplemental Figures IIB and IIIB). In both groups, ABCA1 expression decreased the organ FCRs for 125 I-TC and [ 3 H]CEt significantly ( P <0.05). Similarly, selective CE removal from plasma HDL ([ 3 H]CEt- 125 I-TC) by the liver decreased significantly ( P <0.05) because of Ad-ABCA1 injection.


In adrenals and kidneys of ABCA1 -/- and ABCA1 -L/-L mice, Ad-ABCA1 injection decreased the organ FCRs for 125 I-TC and for [ 3 H]CEt close to those of WT (supplemental Figures II and III).


Hepatic Scavenger Receptor Class B Type I in Mice With Modified ABCA1 Expression


Hepatic HDL selective CE uptake is decreased in BAC + and increased in ABCA1 -/- and in ABCA1 -L/-L mice. Scavenger receptor class B type I (SR-BI) is an HDL receptor that mediates selective lipid uptake. 13,16 Therefore, SR-BI expression in liver lysates isolated from WT, BAC +, ABCA1 -/-, and ABCA1 -L/-L mice was assessed by immunoblotting. In BAC + mice treated with the LXR agonist, hepatic SR-BI expression decreased compared with WT (supplemental Figure I). In contrast, in ABCA1 -/- (supplemental Figure IVA) and in ABCA1 -L/-L mice (supplemental Figure IVB), no increase in SR-BI expression was observed compared with WT liver. Analogously in BAC + ABCA1 -/- mice, there was no change in hepatic SR-BI (supplemental Figure IVA).


Discussion


This study reinforces that ABCA1 has a dominant effect on plasma HDL-C levels. A deficiency of ABCA1 is associated with low and a high expression of this protein with increased HDL-C. The low HDL-C in liver-specific ABCA1-deficient mice and the normalized HDL-C after the adenovirus-mediated transfer of ABCA1 to the liver point to a major role of hepatic ABCA1 as primary molecule that determines HDL-C in vivo.


ABCA1-overexpressing BAC (BAC + ) mice, ABCA1 knockout (ABCA1 -/- ), and liver-specific ABCA1 knockout (ABCA1 -L/-L ) rodents were the models of this study. 5,10,15 Besides, in ABCA1-deficient mice, this protein was expressed via transgene or adenovirus. 4,11 BAC + mice have an increase in HDL-C, and this is attributable to a rise in lipoprotein particle number. 10 The composition of HDL in BAC + and WT mice is virtually the same. 10 ABCA1 -/- mice have essentially no HDL in plasma. 15 ABCA1 -L/-L mice have 20% of normal HDL-C levels, and this decrease is attributable to a reduction in HDL particle number. 5 The size and composition of HDL from ABCA1 -L/-L is very similar to the one from WT animals. 5 Based on these characteristics of the endogenous HDL in the experimental animals, radiolabeled murine WT-HDL was used as tracer. This preparation is an appropriate tracer for the endogenous HDL pool, and this is true at least in BAC + and ABCA1 -L/-L mice. This HDL fraction was labeled in its protein and lipid moieties, and thus, the metabolic fate of both HDL components could be independently explored. 9


A key result of this study is that ABCA1 expression in mice delayed the catabolism of both HDL tracers in plasma, and this yielded a reduced selective CE uptake from plasma HDL by tissues. Strikingly, ABCA1 expression decreased the HDL tracer uptake by the liver, and this yielded a reduced selective CE uptake. The decrease in HDL apolipoprotein catabolism that was observed here is in line with another study using ABCA1-transgenic mice. 17 With respect to whole-body HDL catabolism, quantitatively, the highest HDL tracer uptake rates were detected in the liver, and this was true for BAC + and for WT mice. These results show that the liver is the dominant site for HDL catabolism in mice with physiological and induced ABCA1 overexpression.


These BAC + mice with transgenic ABCA1 expression display an increase in plasma HDL-C. This rise and the decreased HDL catabolism by issues suggests that the ABCA1-mediated delay in HDL catabolism is a mechanism that contributes to the increased plasma HDL-C. However, ABCA1 is a key molecule in the formation of HDL particles as well. 15 Therefore, it seems possible that ABCA1 has a dual effect on both HDL catabolism and synthesis. Both mechanisms presumably contribute to the ABCA1-dependent increase in plasma HDL-C.


HDL catabolism in mice with total or liver-specific ABCA1 deficiency was accelerated. The stimulated decay of both HDL tracers yielded an increase in selective CE uptake from plasma HDL by tissues. With respect to the increased decay of 125 I-labeled apolipoproteins, these experiments agree with previous studies in ABCA1 -L/-L mice 5 and in TD patients. 6 The selective CE clearance from plasma HDL was increased in ABCA1 -/- and ABCA1 -L/-L mice. Similarly, HDL holo-particle catabolism, as represented by 125 I-TC, is stimulated in both models. With respect to specific tissues, liver, adrenal, and kidney uptake of HDL tracers were significantly increased in both ABCA1-deficient animal models, and this resulted in upregulated rates of hepatic and adrenal-selective CE uptake. With respect to whole-body HDL catabolism, again, the HDL uptake rates were highest in the liver. These results provide evidence that ABCA1 in the liver plays an essential role in whole-body HDL metabolism by delaying HDL turnover and by diminishing selective CE uptake from HDL. For ABCA1 -L/-L mice, it has been suggested that the increased catabolism of HDL particles and of HDL apolipoproteins occurs in the kidneys and in the liver. 5 This conclusion is confirmed in this study. Besides the previously described increase in HDL protein uptake in the liver of ABCA1 -L/-L mice, it is demonstrated here that the ABCA1-deficient murine liver displays a substantial increase in selective HDL CE uptake as well. 5


ABCA1-deficient mice have very low HDL-C in plasma. 5,15 Previously, it was suggested that this finding is attributable to a decreased HDL synthesis. 15 However, in this study, HDL catabolism is accelerated in ABCA1-deficient mice. Therefore, the mechanism(s) underlying the low plasma HDL presumably is both attributable to a decrease in HDL synthesis and an increase in HDL catabolism.


Mice with a total ABCA1 deficiency yielded qualitatively identical results as animals with a liver-specific lack of this protein. This is true for both HDL plasma FCRs and organ FCRs. Besides, adenovirus-mediated hepatic ABCA1 expression in ABCA1 -/- and in ABCA1 -L/-L mice or transgene-induced ABCA1 expression reversed the changes in HDL metabolism induced by a deficiency of this protein. Also, these results provide evidence that ABCA1 in the liver plays a dominant role in HDL homeostasis in vivo.


The question has to be addressed whether the increase in HDL catabolism in the absence of ABCA1 is caused by the decreased HDL plasma pool in ABCA1 -/- and ABCA1 -L/-L mice. Patients with TD have an almost complete lack of HDL in plasma, and radiolabeled HDL is rapidly cleared from the circulation. 6,7 However, this rapid HDL catabolism was independent of HDL pool size because it did not change despite the acute infusion of HDL to bring plasma HDL concentrations back to near normal. 7 In TD patients, only the apolipoprotein moiety of HDL was labeled. 7 Therefore, the fate of HDL CE in the face of a diminished HDL pool was unknown. However, another study injected HDL radiolabeled in its unesterified and esterified cholesterol moieties into apoA-I-deficient (apoA-I -/- ) mice with low plasma HDL-C levels and found that compared with WT, there was no difference in the turnover of HDL lipids in apoA-I -/- mice. 18 These observations suggest that the HDL pool size does not affect HDL turnover rates. In summary, it is unlikely that an altered HDL pool size of ABCA1-deficient mice affected the result of this study.


A mechanism by which ABCA1 presumably can alter HDL catabolism in the liver is through the HDL receptor SR-BI. 16 Overexpression of SR-BI decreases plasma HDL-C, accelerates HDL catabolism, and increases selective CE uptake by the liver. 19 In contrast, an induced deficiency of SR-BI increases plasma HDL-C, delays HDL catabolism, and decreases hepatic selective CE uptake. 13 In BAC + mice, hepatic SR-BI expression was reduced, and this observation is consistent with the diminished selective HDL CE uptake by the liver in metabolic studies. However, in ABCA1 -/- and in ABCA1 -L/-L mice, the hepatic expression of SR-BI was similar as in WT controls, although selective HDL CE uptake by the liver was substantially upregulated in vivo. This lack of regulation of SR-BI is consistent with a previous report. 20 One possibility that might explain these discrepancies is an SR-BI-independent mechanism for HDL lipid uptake; such a pathway could mediate hepatic HDL CE uptake at least in part. 13 Besides, a novel HDL receptor has been defined that may play a role in HDL degradation as well. 21


In summary, ABCA1 has a substantial impact on HDL metabolism in plasma and by tissues in mice. ABCA1 overexpression retards the catabolism of HDL in plasma and decreases selective HDL CE uptake by the liver. In contrast, an ABCA1 deficiency accelerates HDL catabolism in plasma and increases HDL-selective CE uptake by the liver. All experiments are in line with a key function of ABCA1 in the liver for HDL metabolism in vivo. Besides, the liver also quantitatively has a dominant function in HDL catabolism in mice with a deficiency or a high level of ABCA1 expression.


Acknowledgments


For Acknowledgments, please see the online supplement.


Disclosures


None.

【参考文献】
  Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest J Jr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22: 336-345.

Wellington CL, Walker EK, Suarez A, Kwok A, Bissada N, Singaraja R, Yang YZ, Zhang LH, James E, Wilson JE, Francone O, McManus BM, Hayden MR. ABCA1 mRNA and protein distribution patterns predict multiple different roles and levels of regulation. Lab Invest. 2002; 82: 273-283.

Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Comm. 1999; 257: 29-33.

Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1. J Lipid Res. 2003; 44: 1470-1480.

Timmins JM, Lee JY, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest. 2005; 115: 1333-1342.

Schaefer EJ, Blum CB, Levy RI, Jenkins LL, Alaupovic P, Foster DM, Brewer HB Jr. Metabolism of high-density lipoprotein apolipoproteins in Tangier disease. N Engl J Med. 1978; 299: 905-910.

Schaefer EJ, Anderson DW, Zech LA, Lindgren FT, Bronzert TB, Rubalcaba EA, Brewer HB Jr. Metabolism of high density lipoprotein subfractions and constituents in Tangier disease following the infusion of high density lipoproteins. J Lipid Res. 1981; 22: 217-228.

Schreyer SA, Hart LK, Attie AD. Hypercatabolism of lipoprotein-free apolipoprotein A-I in HDL-deficient mutant chickens. Arterioscler Thromb Vasc Biol. 1994; 14: 2053-2059.

Glass C, Pittman RC, Civen M, Steinberg D. Uptake of high-density lipoprotein-associated apoprotein A-I and cholesterol esters by 16 tissues of the rat in vivo and by adrenal cells and hepatocytes in vitro. J Biol Chem. 1985; 260: 744-750.

Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang Y, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoA-I-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem. 2001; 276: 33969-33979.

Coutinho JM, Singaraja RR, Kang M, Arenillas DJ, Bertram LN, Bissada N, Staels B, Fruchart JC, Fievet C, Joseph-George AM, Wasserman WW, Hayden MR. Complete functional rescue of the ABCA1 -/- mouse by human BAC transgenesis. J Lipid Res. 2005; 46: 1113-1123.

Plösch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK, Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem. 2002; 277: 33870-33877.

Brundert M, Ewert A, Heeren J, Behrendt B, Ramakrishnan R, Greten H, Merkel M, Rinninger F. Scavenger receptor class B type I mediates the selective uptake of high-density lipoprotein-associated cholesteryl ester by the liver in mice. Arterioscler Thromb Vasc Biol. 2005; 25: 143-148.

Glass CK, Pittman RC, Keller GA, Steinberg D. Tissue sites of degradation of apoprotein A-I in the rat. J Biol Chem. 1983; 258: 7161-7167.

McNeish J, Aiello RJ, Guyot D, Turi T, Gabel C, Aldinger C, Hoppe KL, Roach ML, Royer LJ, de Wet J, Broccardo C, Chimini G, Francone OL. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc Natl Acad Sci U S A. 2000; 97: 4245-4250.

Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science. 1996; 271: 518-520.

Vaisman BL, Lambert G. Amar M, Joyce C, Ito T, Shamburek RD, Cain WJ, Fruchart-Najib J, Neufeld ED, Remaly AT, Brewer HB Jr, Santamarina-Fojo S. ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice. J Clin Invest. 2001; 108: 303-309.

Ji Y, Wang N, Ramakrishnan R, Sehayek E, Huszar D, Breslow JL, Tall AR. Hepatic scavenger receptor BI promotes rapid clearance of high density lipoprotein free cholesterol and its transport into bile. J Biol Chem. 1999; 274: 33398-33402.

Wang N, Arai T, Ji Y, Rinninger F, Tall AR. Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein apoB, low density lipoprotein apoB, and high density lipoprotein in transgenic mice. J Biol Chem. 1998; 273: 32920-32926.

Groen AK, Bloks VW, Bandsma RHJ, Ottenhoff R, Chimini G, Kuipers S. Hepatobiliary cholesterol transport is not impaired in Abca1-null mice lacking HDL. J Clin Invest. 2001; 208: 843-850.

Martinez LO, Jacquet S, Estever JP, Rolland C, Cabezon E, Champagne E, Pineau T, Georgeaud V, Walker JE, Terce F, Collet X, Perret B, Barbaras R. Ectopic beta-chain of ATP synthase is an apolipoprotein A-I receptor in hepatic HDL endocytosis. Nature. 2003; 421: 75-79.


作者单位:University of British Columbia (R.R.S., N.B., M.K., M.R.H.), Vancouver, Canada; University Hospital Eppendorf (B.S., M.B., M.M., J.H., F.R.), Hamburg, Germany; Wake Forest University (J.M.T., J.S.P.), Winston-Salem, NC; and Columbia University (R.R.), New York, NY.

日期:2008年12月28日 - 来自[2006年第26卷第8期]栏目
循环ads

Macrophage ATP-Binding Cassette Transporter A1 Overexpression Inhibits Atherosclerotic Lesion Progression in Low-Density Lipoprotein Receptor Knockout Mice

【摘要】  Background- ATP-binding cassette transporter A1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. Previously, we have shown that inactivation of macrophage ABCA1 induces atherosclerosis in low-density lipoprotein receptor knockout (LDLr-/-) mice. However, the possibly beneficial effects of specific upregulation of macrophage ABCA1 on atherogenesis are still unknown.

Methods and Results- Chimeras that specifically overexpress ABCA1 in macrophages were generated by transplantation of bone marrow from human ABCA1 bacterial artificial chromosome (BAC) transgenic mice into LDLr-/- mice. Peritoneal macrophages isolated from the ABCA1 BAC LDLr-/- chimeras exhibited a 60% ( P =0.0006) increase in cholesterol efflux to apolipoprotein AI. To induce atherosclerosis, the mice were fed a Western-type diet containing 0.25% cholesterol and 15% fat for 9, 12, and 15 weeks, allowing analysis of effects on initial lesion development as well as advanced lesions. No significant effect of macrophage ABCA1 overexpression was observed on atherosclerotic lesion size after 9 weeks on the Western-type diet (245±36 x 10 3 µm 2 in ABCA1 BAC LDLr-/- mice versus 210±20 x 10 3 µm 2 in controls). However, after 12 weeks, the mean atherosclerotic lesion area in ABCA1 BAC LDLr-/- mice remained only 164±15 x 10 3 µm 2 ( P =0.0008) compared with 513±56 x 10 3 µm 2 in controls (3.1-fold lower). Also, after 15 weeks on the diet, lesions in mice transplanted with ABCA1 overexpressing bone marrow were still 1.6-fold smaller (393±27 x 10 3 µm 2 compared with 640±59 x 10 3 µm 2 in control transplanted mice; P =0.0015).

Conclusion- ABCA1 upregulation in macrophages inhibits the progression of atherosclerotic lesions.

ATP-binding cassette transporter 1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. To investigate the therapeutic benefit of upregulation of macrophage ABCA1, chimeras were created that specifically overexpress ABCA1 in macrophages by bone marrow transplantation. The studies show that ABCA1 upregulation in macrophages inhibited the progression of atherosclerotic lesions.

【关键词】  atherosclerosis leukocytes cholesterol transplantation


Introduction


Atherosclerotic cardiovascular disease is the major cause of morbidity and mortality in Western societies. The genesis and progression of atherosclerotic lesions involves a complicated sequence of events in which various cell types in the arterial wall, including macrophages, play an important role. 1 Deposition of excessive amounts of cholesterol in macrophages leading to their transformation into foam cells is a pathological hallmark of atherosclerosis. Macrophages cannot limit their uptake of cholesterol via scavenger receptors. 2 Therefore, cholesterol efflux is an important mechanism to maintain cholesterol homeostasis in macrophages and to prevent atherosclerotic lesion development. Epidemiological studies have shown a strong inverse relationship between low plasma cholesterol levels and coronary artery disease. 3-5 It is currently generally accepted that high plasma levels of high-density lipoprotein (HDL) protect against the development of atherosclerosis. Several mechanisms have been proposed by which HDL inhibits the development and progression of atherosclerosis, including protection against oxidative damage, inhibition of endothelial dysfunction, and anti-inflammatory effects. 6,7 Most important, HDL facilitates reverse cholesterol transport, a process by which excess cholesterol from peripheral tissues is transferred via the plasma to the liver for either recycling or excretion from the body as bile. 8 A key regulator of cholesterol efflux from macrophages is ATP-binding cassette transporter 1 (ABCA1). Mutations in ABCA1 cause Tangier disease, an autosomal recessive disorder that is characterized by severe HDL deficiency and increased susceptibility to atherosclerosis. 9-11 In addition, several lines of evidence indicate that ABCA1 gene variations may contribute to the interindividual variability in atherosclerosis susceptibility in humans. 12-14 Activation of ABCA1 is thus an attractive target for development of therapeutic interventions. Overexpression of ABCA1 in mice decreases atherosclerosis in apolipoprotein E (apoE) knockout 15 and C57BL/6 mice. 16 We have previously shown bone marrow transplantation to be a useful technique to study the role of macrophage ABCA1 in atherosclerosis. Specific disruption of ABCA1 in macrophages using bone marrow transplantation resulted in an increased susceptibility to atherosclerotic lesion development without altering plasma HDL levels, providing evidence that macrophage ABCA1 plays a critical role in the protection against atherosclerosis, independent of effects on HDL cholesterol. 17 The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels. 18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells. Therefore, it is conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. To study the therapeutic potential of upregulation of macrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from human ABCA1 overexpressing bacterial artificial chromosome (BAC) transgenic mice into low-density lipoprotein (LDL) receptor knockout (LDLr-/-) mice. The findings from these studies revealed that specific upregulation of macrophage ABCA1 prevents progression of atherosclerosis and thus is an attractive therapeutic target for the prevention of atherosclerotic lesion development.


Methods


Mice


ABCA1 BAC transgenic mice hemizygous for the human ABCA1 gene were described previously. 20 Nontransgenic littermates were used as controls. LDLr-/- mice were obtained from the Jackson Laboratory (Bar Harbor, Me). Mice were maintained on sterilized regular chow containing 4.3% (w/w) fat and no cholesterol (RM3; Special Diet Services) or fed a Western-type diet containing 15% (w/w) fat and 0.25% (w/w) cholesterol (Diet W; Hope Farms). Drinking water was supplied with antibiotics (83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulfate) and 6.5 g/L sucrose. Animal experiments were performed at the Gorlaeus laboratories of the Leiden/Amsterdam Center for Drug Research in accordance with the national laws. All experimental protocols were approved by the ethics committee for animal experiments of Leiden University.


Bone Marrow Transplantation


To induce bone marrow aplasia, male LDLr-/- recipient mice were exposed to a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) total body irradiation using an Andrex Smart 225 Röntgen source (YXLON International) with a 6-mm aluminum filter 1 day before the transplantation. Bone marrow was isolated by flushing the femurs and tibias from male ABCA1 BAC or wild-type (WT) littermates. Irradiated recipients received 0.5 x 10 7 bone marrow cells by tail vein injection.


Assessment of Chimerism


The hematologic chimerism of the LDLr-/- mice was determined using genomic DNA from bone marrow by polymerase chain reaction (PCR) at 20 weeks after transplant. The forward and reverse primers 5'GGCTGGATTAGCAGTCCTCA3' and 5'ATCCCCAACTCAAAACCACA3' for human ABCA1 and 5'TGGGAACTCCTAAAAT3' and 5'CCATGTGGTGTGTAGACA3' for mouse ABCA1 gene were used. Murine and human ABCA1 mRNA expression relative to 18Sr-RNA in peritoneal macrophages was quantitatively determined on an ABI Prism 7700 Sequence Detection system (Applied Biosystems) using the following primers and probes for human ABCA1: forward, 5'CCTGACCGGGTTGTTCCC3'; reverse, 5'TTCTGCCGGATGGTGCTC3'; probe, 5'ACATCCTGGGAAAAGACATTCGCTCTGA3' and for murine ABCA1: forward, 5'TCCGAGCGAATGTCCTTC3'; reverse, 5'GCGCTCAACTTTTACGAAGGC3'; probe, 5'CCCAACTTCTGGCACGGCCTACATC3'. For analyses of ABCA1 protein expression, 100 to 150 µg of protein was separated on 7.5% polyacrylamide gels and was transferred to polyvinylidene difluoride membranes (Millipore) and probed with ABCA1PEP4 antibody 20 or anti-GAPDH (Chemicon) as a control. Immunolabeling was detected by enhanced chemiluminescence (Amersham Pharmacia Biotech), and protein levels were quantitated using NIH Image software.


Macrophage Cholesterol Efflux Studies


Thioglycollate-elicited peritoneal macrophages were incubated with 0.5 µCi/mL 3 H-cholesterol in DMEM/0.2% BSA for 24 hours at 37°C. To determine cholesterol loading, cells were washed 3 times with washing buffer (50 mmol/L Tris containing 0.9% NaCl, 1 mmol/L EDTA, and 5 mmol/L CaCl2, pH 7.4), lysed in 0.1 mol/L NaOH, and the radioactivity was determined by liquid scintillation counting. Cholesterol efflux was studied by incubation of the cells with DMEM/0.2% BSA alone or supplemented with either 10 µg/mL apoAI (Calbiochem) or 50 µg/mL human HDL. Radioactivity in the medium was determined by scintillation counting after 24 hours of incubation.


Serum Lipid Analyses


After an overnight fast, blood was drawn from each mouse by tail bleeding. Total cholesterol, triglycerides, and phospholipids in serum were determined using enzymatic colorimetric assays (Roche Diagnostics). The distribution of lipids over the different lipoproteins was determined by fractionation using a Superose 6 column (3.2 x 30 mm; Smart-system; Pharmacia). Total cholesterol, triglyceride, and phospholipid contents in the effluent were determined as above.


Histological Analysis of the Aortic Root


To analyze the effect of macrophage ABCA1 overexpression on atherosclerosis, transplanted mice were euthanized after 9, 12, and 15 weeks on the Western-type diet. The atherosclerotic lesion areas in oil red O-stained cryostat sections of the aortic root were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a video camera and Leica Qwin Imaging software (Leica Ltd.). Mean lesion area (in µm 2 ) was calculated from 10 oil red O-stained sections, starting at the appearance of the tricuspid valves. For the assessment of macrophage infiltration, sections were immunolabeled with MOMA-2 (generous gift of Dr G. Kraal, Vrije Universiteit, Amsterdam, The Netherlands). The amount of collagen in the lesions was determined using Masson?s Trichrome Accustain according to manufacturer instructions (Sigma Diagnostics). TUNEL staining of lesions was performed using the In Situ Cell Death Detection kit (Roche). TUNEL-positive nuclei were visualized with Nova Red (Vector), and sections were counterstained with 0.3% methylgreen. Sections treated with DNase (2U per section) served as positive control. All quantifications were done blinded by computer-aided morphometric analysis using the Leica image analysis system.


Statistical Analyses


Statistical analyses were performed using the unpaired Student t test (Instat GraphPad software).


Results


Generation of LDLr-/- Mice Overexpressing Macrophage ABCA1


To assess the therapeutic potential of increasing macrophage ABCA1 to prevent atherosclerotic lesion development, we used bone marrow transplantation to selectively upregulate ABCA1 in hematopoietic cells. Bone marrow from ABCA1 overexpressing BAC transgenic mice was transplanted into LDLr-/- mice, which represent an established model for the development of atherosclerosis. Genomic DNA isolated from the LDLr-/- mice transplanted with bone marrow from ABCA1 BAC transgenic mice contained both the human and the mouse ABCA1 transcript, whereas the control transplanted group contained only mouse ABCA1, indicating that the bone marrow transfer was successful ( Figure 1 A). No effect was observed of human ABCA1 overexpression on murine ABCA1 mRNA levels (0.27±0.06 and 0.24±0.03 for human ABCA1 overexpressing macrophages and WT macrophages, respectively). Overexpression of ABCA1 in macrophages resulted in a 2.5-fold increase in ABCA1 protein expression ( Figure 1 B) and a 60% (n=3; P =0.0006) increase in cholesterol efflux to apoAI ( Figure 1 C).


Figure 1. Verification of success of bone marrow transplantation. A, Verification of successful reconstitution with donor hematopoietic cells by PCR amplification of the human ABCA1 and murine ABCA1 gene at 20 weeks after transplant using genomic DNA isolated from bone marrow. B, Analyses of the effect of ABCA1 overexpression on macrophage ABCA1 protein levels by Western blotting. C, ApoAI and HDL induced cellular cholesterol efflux from 3 H-cholesterol-labeled peritoneal macrophages isolated from LDLr-/- mice transplanted with either ABCA1 BAC (n=3) or control (n=3) bone marrow at 20 weeks after transplant. Statistically significant difference *** P <0.001 compared with WT LDLr-/- mice.


Effect of Macrophage ABCA1 Overexpression on Plasma Lipid Levels


On regular chow diet, the majority of the cholesterol in LDLr-/- mice is transported by LDL and HDL, phospholipids by HDL, and triglycerides by very low-density lipoprotein (VLDL) and LDL ( Figure 2 ). In contrast to the ABCA1 BAC transgenic mice that displayed mildly increased HDL cholesterol levels, 20 no significant effect on HDL cholesterol, triglyceride, or phospholipid levels was observed when ABCA1 was overexpressed solely in macrophages.


Figure 2. Effect of macrophage ABCA1 overexpression in LDLr-/- mice on serum cholesterol, phospholipid, and triglyceride distribution. Blood samples were drawn after an overnight fast at 8 weeks after transplant while feeding regular chow diet (CHOW) and at 17 weeks after bone marrow transplantation after 9 weeks of feeding a high cholesterol Western-type diet (WTD). Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 to 7 represent VLDL; fraction 8 to 14, LDL; and fractions 15 to 19, HDL, respectively. The distribution of cholesterol, phospholipids, and triglycerides over the different lipoproteins in WT LDLr-/- ( ) and ABCA1 BAC LDLr-/- () chimeras is shown. Values represent the mean±SEM of 12 mice. No statistically significant differences were observed.


To induce atherosclerotic lesion development, the transplanted mice were fed Western-type diet starting at 8 weeks after transplantation. On diet feeding, serum cholesterol levels increased &3-fold in both groups of mice because of an increase in VLDL and LDL cholesterol ( Table ). The increase in VLDL and LDL cholesterol coincided with an increase in phospholipids. No significant effect of macrophage ABCA1 overexpression on serum lipid levels or lipid distribution among the different lipoproteins was observed ( Figure 2 ).


Effect of Leukocyte ABCA1 Overexpression in LDLr-/- Mice on Serum Lipid Levels


Effect of Macrophage ABCA1 Overexpression on Atherosclerotic Lesion Initiation and Progression


To investigate the therapeutic potential of increasing macrophage ABCA1 expression as a means of preventing atherosclerosis, we assessed whether and to what degree upregulation of ABCA1 in macrophages affected lesion formation. Lesion development was analyzed in the aortic root of WT LDLr-/- mice and in ABCA1 BAC LDLr-/- chimeras after 9, 12, and 15 weeks of Western-type diet feeding ( Figure 3 ). After 9 weeks on the Western diet, no significant effect of macrophage ABCA1 overexpression on the atherosclerotic lesion size was observed (245±36 x 10 3 µm 2 in ABCA1 BAC LDLr-/- mice [n=11] versus 210±20 x 10 3 µm 2 in controls [n=11]). Lesions in both groups of mice were primarily composed of macrophage-derived foam cells (94±2.3% and 94±2.1% for WT and ABCA1 BAC transplanted mice, respectively), indicating that macrophage ABCA1 overexpression does not prevent foam cell formation and thus the initiation of atherosclerosis. Between 9 and 12 weeks of diet feeding, atherosclerosis in the mice transplanted with control bone marrow progressed further in size to 513±56 x 10 3 µm 2 (n=14). However, in the ABCA1 BAC LDLr-/- mice, no time-dependent increase in lesion size was observed. The mean atherosclerotic lesion area was thus 3.1-fold smaller (164±15 x 10 3 µm 2; n=14, P =0.0008) compared with control transplanted animals. Interestingly, at this time point, lesions were still primarily composed of macrophage-derived foam cells (88±3.0% and 91±4.0% for WT and ABCA1 BAC transplanted mice, respectively). Thus, although macrophage ABCA1 overexpression did not inhibit the initiation of foam cell formation, the progression of lesions was markedly inhibited by upregulation of ABCA1 in macrophages. Between 12 and 15 weeks of diet feeding, lesions in control transplanted mice had progressed only slightly in size to 640±59 x 10 3 µm 2 (n=9), whereas lesion development in mice transplanted with ABCA1 overexpressing bone marrow had increased to 393±27 x 10 3 µm 2 (n=9; P =0.0015). At this time point, the lesion composition was markedly different. The macrophage content of the lesions of mice transplanted with WT bone marrow was 40±4.0%, whereas the collagen content was 15±2.2%. In contrast, mice transplanted with ABCA1 overexpressing bone marrow contained more macrophages and less collagen (53±3.9% [ P =0.026] and 8.9±1.1% [ P =0.029], respectively), indicative of less advanced lesions. Also, a predominant part of the lesions consisted of acellular necrotic areas. However, the acellular area of the lesions of mice reconstituted with ABCA1 overexpressing bone marrow was 2-fold smaller compared with control transplanted animals (53±17 x 10 3 µm 2 in ABCA1 BAC and 108±20 x 10 3 µm 2 in WT, respectively; P =0.057). Thus, although lesion progression was not completely halted by overexpression of ABCA1 in macrophages, the progression was still largely reduced.


Figure 3. Macrophage ABCA1 overexpression in LDLr-/- mice prevents atherosclerotic lesion progression. Formation of atherosclerotic lesions was determined at 17, 20, and 23 weeks after transplant at the aortic root of WT LDLr-/- and ABCA1 BAC LDLr-/- chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. The mean lesion area was calculated from oil red O-stained cross-sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 9 to 14 mice. Original magnification x 50. Lesions in ABCA1 BAC LDLr-/- mice showed a statistically significant difference of *** P <0.001 or ** P< 0.01 when compared with WT LDLr-/- mice.


Because ABCA1 has been implicated in the removal of apoptotic cells, the effect of macrophage ABCA1 overexpression on the number of TUNEL-positive cells was determined at the different stages of lesion development ( Figure 4 ). After 9 weeks on Western-type diet, no effect of macrophage ABCA1 overexpression on the absolute number of TUNEL-positive cells in the lesions was observed. However, after 12 and 15 weeks, the number of TUNEL-positive cells was significantly lower in the ABCA1 BAC transplanted animals. In addition, the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was also observed at 9 weeks on Western-type diet and was independent of the extent of lesion development.


Figure 4. Effect of macrophage ABCA1 overexpression in LDLr-/- mice on apoptosis in atherosclerotic lesions. Numbers of apoptotic nuclei were quantified in atherosclerotic lesions at the aortic root of WT LDLr-/- and ABCA1 BAC LDLr-/- chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. Apoptosis is expressed as the absolute number of TUNEL-positive nuclei (left) and the percentage TUNEL-positive to total nuclei (right) in the atherosclerotic lesion. The absolute number of apoptotic nuclei in lesions in ABCA1 BAC LDLr-/- mice showed a statistically significant difference of * P <0.05 when compared with WT LDLr-/- (open bars) mice. Two-way ANOVA analysis showed that the percentage of apoptotic nuclei to the total number of nuclei was significantly lower ( P <0.05) in lesions of ABCA1 BAC LDLr-/- (closed bars) mice.


Discussion


Insights into the role of ABCA1 in atherogenesis have been gained from both patients affected with Tangier disease and recently developed animal models. Patients with mutations in ABCA1 are significantly at risk for coronary artery disease. 21,22 The cardioprotective effects of ABCA1 have been confirmed recently in animal models. Overexpression of ABCA1 resulted in decreased susceptibility to spontaneous atherosclerosis in apoE knockout mice 15 and in C57BL/6 mice with diet-induced atherosclerosis. 16 In addition to its expression in macrophages, ABCA1 is also highly expressed by hepatocytes in the liver, where it is important for HDL lipidation. 23-26 In agreement, the reduction in atherosclerosis susceptibility as a result of ABCA1 overexpression coincided with an increase in HDL cholesterol levels. Using bone marrow transplantation, we 17 and Aeillo et al 27 have shown that selective inactivation of ABCA1 in macrophages results in markedly increased atherosclerosis in different animal models without affecting HDL cholesterol levels. ABCA1-dependent cholesterol efflux is thus a crucial factor in the prevention of excessive cholesterol accumulation in macrophages of the arterial wall and their transformation into foam cells.


To study the therapeutic potential of upregulation of macrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from human ABCA1 BAC transgenic mice into LDLr-/- mice. In this study, we show that overexpression of ABCA1 in macrophages did not influence initial lesion development in LDLr-/- mice. However, specific deletion of macrophage ABCA1 in LDLr-/- mice did induce initial lesion development (M.V.E., unpublished data, 2005). The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels. 18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells. It is therefore conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. As a result, further upregulation of ABCA1 expression does not inhibit initial lesion development. However, ABCA1 overexpression did inhibit the progression of the size of these fatty streak lesions. During the progression of atherosclerosis, macrophage foam cells accumulate large amounts of unesterified cholesterol, a process that is thought to contribute to macrophage death. 28 Increased levels of intracellular free cholesterol accelerate the degradation of ABCA1 in macrophages. 29 In agreement, Albrecht et al recently showed that the microenvironment of the atherosclerotic plaque induces ABCA1 protein degradation. 30 This might provide a possible explanation for the fact that overexpression of ABCA1 did not inhibit initial lesion formation, whereas the progression of these lesions was inhibited. Progression of atherosclerotic lesions is also characterized by an ongoing chronic inflammatory reaction and extensive cellular necrosis and apoptosis. 31 Several lines of evidence have suggested a role for ABCA1 in the engulfment of apoptotic cells. 32-34 In agreement, we demonstrate that the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was independent of the extent of lesion development. It is thus unlikely that the protective effects of macrophage ABCA1 overexpression in later stages of lesion development are solely the result of accelerated clearance of apoptotic cells.


In conclusion, the important effect of macrophage ABCA1 overexpression in prevention of atherosclerotic lesion progression reported in this study renders this transporter an attractive target for the development of novel therapeutic agents designed to prevent the progression of atherosclerosis.


Acknowledgments


This work was supported by the Netherlands Heart Foundation (grant 2001T041) and an International HDL research award awarded to M.V.E.

【参考文献】
  Ross R. Atherosclerosis-An inflammatory disease. N Engl J Med. 1991; 340: 115-125.

Graeves DR, Gough PJ, Gordon S. Recent progress in defining the role of scavenger receptors in transport, atherosclerosis and host defense. Curr Opin Lipidol. 1998; 9: 425-432.

Miller GJ, Miller NE. Plasma high-density-lipoprotein concentration and development of ischemic heart disease. Lancet. 1975; 1: 16-19.

Wilson PWF, Abbott RD, Castelli WP. High density lipoprotein cholesterol and mortality: the Framingham Heart Study. Arteriosclerosis. 1988; 8: 737-741.

Goldbourt U, Yaari S, Medalie JH. Isolated low HDL cholesterol as a risk factor for coronary heart disease mortality: a 21 year follow-up of 8000 men. Arterioscler Thromb Vasc Biol. 1997; 17: 107-113.

Barter PJ, Nicholls S, Rye KA, Anantharamaiah GM, Navab M, Fogelman AM. Antiinflammatory properties of HDL. Circ Res. 2004; 95: 764-772.

Assmann G, Gotto AM Jr. HDL cholesterol and protective factors in atherosclerosis. Circulation. 2004; 109: III8-III14.

Von Eckardstein A, Nofer JR, Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler Thromb Vasc Biol. 2001; 21: 13-27.

Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest JJr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22: 336-345.

Bodzioch M, Orso M, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22: 347-351.

Rust S, Rosier M, Funke H, von Eckardstein A, Cullen P, Kroes HY, Hordijk R, Geisel J, Kastelein J, Molhuizen HO, Schreiner M, Mischke A, Hahmann HW, Assmann G. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat Genet. 1999; 22: 352-355.

Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest JJr, Kastelein JJ, Hayden MR. Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease. Circulation. 2001; 103: 1198-1205.

Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F. In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction. Arterioscler Thromb Vasc Biol. 2004; 24: 775-781.

Brousseau ME, Bodzioch M, Schaefer EJ, Goldkamp AL, Kielar D, Probst M, Ordovas JM, Aslanidis C, Lackner KJ, Bloomfield Rubins H, Collins D, Robins SJ, Wilson PW, Schmitz G. Common variants in the gene encoding ATP-binding cassette transporter 1 in men with low HDL cholesterol levels and coronary heart disease. Atherosclerosis. 2001; 154: 607-611.

Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart JC, McManus BM, Staels B, Hayden MR. Increased ABCA1 activity protects against atherosclerosis. J Clin Invest. 2002; 110: 35-42.

Joyce CW, Amar MJ, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RFJr, Neufeld ED, Remaley AT, Fredrickson DS, Brewer HBJr, Santamarina-Fojo S. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice. Proc Natl Acad Sci U S A. 2002; 99: 407-412.

Van Eck M, Bos IST, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van AmersfoortES, Christiansen-Weber TA, Fung-Leung WP, Van BerkelTJ, Schmitz G. Leukocyte ATP-binding cassette transporter A1 (ABCA1) deficiency promotes atherosclerotic lesion development. Proc Natl Acad Sci U S A. 2002; 99: 6298-6303.

Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. l. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257: 29-33.

Wade DP, Owen JS. Regulation of the cholesterol efflux gene, ABCA1. Lancet. 2001; 357: 161-163.

Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements intron 1. J Biol Chem. 2001; 276: 33969-33979.

Clee SM, Kastelein JJ, Van Dam M, Marcil M, Roomp K, Zwarts KY, Collins JA, Roelants R, Tamasawa N, Stulc T, Suda T, Ceska R, Boucher B, Rondeau C, DeSouich C, Brooks-Wilson A, Molhuizen HO, Frohlich J, Genest JJr, Hayden MR. Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes. J Clin Invest. 2000; 106: 1263-1270.

Van DamMJ, de Groot E, Clee SM, Hovingh GK, Roelants R, Brooks-Wilson A, Zwinderman AH, Smit AJ, Smelt AH, Groen AK, Hayden MR, Kastelein JJ. Association between increased arterial-wall thickness and impairment in ABCA1-driven cholesterol efflux: an observational study. Lancet. 2002; 359: 37-41.

Kiss RS, McManus DC, Franklin V, Tan WL, McKenzie A, Chimini G, Marcel YL. The lipidation by hepatocytes of human apolipoprotein A-I occurs by both ABCA1-dependent and -independent pathways. J Biol Chem. 2003; 278: 10119-10127.

Basso F, Freeman L, Knapper Cl, Remaley A, Stonik J, Neufeld EB, Tansey T, Amar MJ, Fruchart-Najib J, Duverger N, Santamarina-Fojo S, Brewer HB Jr. Role of the hepatic ABCA1 transporter in modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res. 2003; 44: 296-302.

Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1. J Lipid Res. 2003; 44: 1470-1480.

Timmins JM, Lee J-Y, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest. 2005; 115: 1333-1142.

Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22: 630-637.

Tabas I. Free cholesterol-induced cytotoxicity. A possible contributing factor to macrophage foam cell necrosis in advanced atherosclerotic lesions. Trends Cardiovasc Med. 1997; 7: 256-263.

Feng B, Tabas I. ABCA1-mediated cholesterol efflux is defective in free cholesterol-loaded macrophages. J Biol Chem. 2002; 277: 43271-43280.

Albrecht C, Soumian S, Amey JS, Sardini A, Higgins CF, Davies AH, Gibbs RG. ABCA1 expression in carotid atherosclerotic plaques. Stroke. 2004; 35: 2801-2806.

Geng Y-J, Libby P. Progression of the atheroma. A struggle between death and procreation. Arterioscler Thromb Vasc Biol. 2002; 22: 1370-1380.

Hamon Y, Chambenoit O, Chimini G. ABCA1 and the engulfment of apoptotic cells. Biochim Biophys Acta. 2002; 1585: 64-71.

Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J. 1996; 15: 226-235.

Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol. 2000; 2: 399-406.


作者单位:Division of Biopharmaceutics (M.V.E., D.Y., R.B.H., T.J.C.V.B.) Leiden/Amsterdam Center for Drug Research, Gorlaeus Laboratories, Leiden University, Leiden, The Netherlands; Centre for Molecular Medicine and Therapeutics (R.R.S., E.R.J., M.R.H.), Children?s and Women?s Hospital, University of Britis

日期:2008年12月28日 - 来自[2006年第26卷第4期]栏目

Activation of ATP-Binding Cassette Transporter A1 Transcription by Chromatin Remodeling Complex

From the Cardiovascular Research Institute (J.H., M.V., P.E.F., C.J.F.) and Departments of Medicine (P.E.F) and Physiology (C.J.F.), University of California, San Francisco.

Correspondence to Jarkko Huuskonen, University of California San Francisco, Cardiovascular Research Institute, Box 0130, San Francisco, CA 94143. E-mail jhuu6676@itsa.ucsf.edu

    Abstract

Objective— Liver X receptor (LXR) regulates the transcription of ATP-binding cassette transporter A1 (ABCA1) by binding to the DR-4 promoter element as a heterodimer with retinoid X receptor (RXR). The role of chromatin remodeling complex in LXR or ABCA1 activation has not been established previously. In this study, we investigated the activation of ABCA1 by brahma-related gene 1 (BRG-1) and brahma, members of the SWI/SNF (mating type switching/sucrose nonfermenting) chromatin remodeling complex.

Methods and Results— Overexpression of wild-type BRG-1 in SW-13 cells, but not a catalytically inactive mutant, increased ABCA1 mRNA levels determined by RT-PCR. These effects were enhanced by LXR and RXR agonists. In 293T (epithelial kidney cell line) and Hep3B (hepatocyte cell line) cells, small interfering RNA against BRG-1/brm also affected ABCA1 mRNA levels. Synergistic activation of ABCA1 was obtained after coexpressing BRG-1 and SRC-1, a coactivator of LXR. Luciferase assays showed that this activation of ABCA1 was dependent on the promoter DR-4 element. Coimmunoprecipitation and chromatin immunoprecipitation studies indicated that the mechanism of BRG-1–mediated activation of ABCA1 involved interaction of LXR/RXR with BRG-1 and binding of this complex to ABCA1 promoter.

Conclusions— Catalytic subunits of SWI/SNF chromatin remodeling complex, BRG-1 and brahma, play significant roles in enhancing LXR/RXR–mediated transcription of ABCA1 via the promoter DR-4 element.

Catalytic subunits of SWI/SNF chromatin remodeling complex, BRG-1 and brahma, enhanced ABCA1 transcription via the promoter DR-4 element. Physical interaction of LXR/RXR and BRG-1 and recruitment of BRG-1 to ABCA1 promoter was demonstrated. These results indicate that chromatin remodeling regulates ABCA1 transcription.

Key Words: ABCA1 ? HDL metabolism ? LXR ? chromatin remodeling ? BRG-1

    Introduction 

Eucaryotic DNA is assembled into nucleosomes. Their compact structure normally has a repressive effect on gene transcription. Two main classes of complexes exist that disrupt this chromatin structure and make it accessible for transcription factors and coregulators. One class covalently modifies histones and coregulators by changing the acetylation, phosphorylation, methylation, and ubiquitination patterns.1 The other class of chromatin modifiers uses ATP hydrolysis to disrupt histone–DNA interactions and change chromatin structure.2,3 These ATP-dependent chromatin remodeling complexes are divided into 4 main groups based on the relative similarity of the central ATPase subunit: the SWI/SNF (mating type switching/sucrose nonfermenting) family, the ISWI family, the CHD/Mi-2 family, and the Ino80 family.2,3

The best characterized complex of the chromatin remodeling complexes is human SWI/SNF. This complex always contains either BRG-1 (brahma-related gene 1; hSNF2?) or brm (brahma; hSNF2) as the catalytic subunit, together with 10 associated factors (BAFs).4 BRG-1 and brm share 70% sequence identity and enhance the transcription of genes regulated by several transcription factors, including nuclear hormone receptors (androgen receptor [AR], estrogen receptor [ER], glucocorticoid receptor [GR], progesterone receptor [PR], and retinoic acid receptor [RAR]), c-Myc, erythroid Kruppel-like factor (EKLF), CCAAT enhancer-binding protein beta (C/EBP?), and aryl hydrocarbon receptor/AHR nuclear translocator (AHR/ARNT).5–9 Recruitment of chromatin remodeling complex to target promoters is achieved either by direct interaction of BRG-1/brm with transcription factors or via bridging molecules such as p300/CREB-binding protein (CBP) and BAFs, which bind to nuclear receptors.4,10,11 BRG-1 and other subunits of mammalian SWI/SNF complexes also associate with retinoblastoma proteins and histone deacetylases exerting transcriptional repression.4

ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism.12 This membrane transporter facilitates the transfer of phospholipids to apolipoprotein A-I, the major protein constituent of HDL, thus initiating the formation of HDL. Several studies using either overexpression or inactivation of ABCA1 in mice have demonstrated the atheroprotective nature of this transporter.12 The transcriptional regulation of ABCA1 is complex and includes the use of alternative transcription start sites and competitive binding of several nuclear receptor dimers to the same DR-4 element in ABCA1 promoter.13–18 Liver X receptor (LXR) is a nuclear receptor that binds to the DR-4 element of target promoters as a heterodimer with retinoid X receptor (RXR).19 LXR/RXR heterodimers are activated by oxysterols (LXR ligands) and retinoic acid (RXR ligand) and can enhance the transcription of several important genes involved in lipid metabolism and inflammation.19 ABCA1 is activated by LXR and RXR agonists in vitro and in vivo.16,20 In mice, these agonists increase HDL levels and inhibit atherogenesis.21 In this study, we demonstrated that SWI/SNF chromatin remodeling complex interacts directly with LXR/RXR heterodimer complex and greatly enhances the transcription of ABCA1.

    Methods

A detailed Materials and Methods section is available online at http://atvb.ahajournals.org.

Transfections and Luciferase Assay

Transient transfections into SW-13 cells were performed using Fugene 6 (Roche) according to manufacturer instructions. One day after transfection, the medium was changed to DMEM with albumin and antibiotics, together with the other additions as shown for individual experiments. The final concentration for 22(R)-OH and 9-cis retinoic acid (CRA) was 10 μmol/L. After 24 hours, cells were harvested for experiments. Luciferase assays were performed using a dual-assay system.

RNA Interference in 293T and Hep3B Cells

Hep3B (hepatocyte cell line) and 293T (epithelial kidney cell line) cells were seeded on 24-well plates (1x105 for Hep3B and 2x105 cells for 293T) 1 day before transfection. The small interfering RNA (siRNA; synthesized by Dharmacon) targeting human BRG-1 and brm (sense sequence r(GCUGGAGAAGCAGCAGAAG)d(TT))22 was transfected into cells using Dharmafect 1 (Dharmacon) according to manufacturer instructions. Twenty-four hours after transfection, the media was changed as described above. RNA was isolated 48 hours after transfection and sodium dodecyl sulfate samples were collected at the 72-hour time point.

Reverse Transcription–Polymerase Chain Reaction

RT-PCR was performed as described previously.18

In Vivo Dithiobis(succinimidylpropionate) (DSP) Cross-Linking

Coimmunoprecipitation of LXR/RXR and BRG-1 from cross-linked 293 cells stably overexpressing FLAG-tagged LXR was performed as described previously.23,24

Chromatin Immunoprecipitation

Chromatin immunoprecipitation (ChIP) assays from 293 cells stably overexpressing FLAG-tagged LXR, 293T cells, and Hep3B cells were performed as described previously.25 Two improvements to the protocol were made. Cells were washed twice with PBS and first cross-linked 20 minutes at room temperature with 1.6 mmol/L DSP (see above) before formaldehyde cross-linking. This enhanced the binding of BRG-1 to the LXR/RXR complex. This is in agreement with Kurdistani et al, who found that histone deacetylase Rpd3 binding to the inositol-1-phosphate synthase (INO1) promoter was enhanced by previous cross-linking with several protein–protein cross-linkers.26 Thus, this double cross-linking method is especially useful in studying components of transcription factor complexes that do not directly interact with DNA. After lysing the cells, the nuclei were digested with 2 U of micrococcal nuclease for 10 minutes at +37°C in the same lysis buffer supplemented with 1.3 mmol/L CaCl2. The reaction was stopped by addition of 0.3 mmol/L EGTA. The micrococcal nuclease treatment of the nuclei before sonication made the chromatin more accessible and produced smaller, more uniform chromatin fragments, reducing the background of the ChIP assay. PCR was performed with Taq polymerase (Qiagen).

    Results

BRG-1 Upregulates ABCA1 mRNA Levels

To test whether human SWI/SNF chromatin remodeling complex plays a role in the transcriptional activation of ABCA1, we used adenocarcinoma cell line SW-13, which lacks the ATP-hydrolyzing subunits BRG-1 and brm of the complex.27 Western blotting of the nuclear extracts shows that these cells expressed nuclear receptors LXR and RXR, as well as coactivators SRC-1 and p300 and corepressors SMRT and nuclear receptor corepressor (NCoR) (please see online supplement). Each of these coregulators had been shown to influence ABCA1 transcription in previous studies.25,28,29 The LXR and RXR ligands, 22(R)-OH and 9-CRA, respectively, did not have a major influence on the amount of LXR, RXR, or coregulators in SW-13 cells. These results indicate that SW-13 cells contain the normal coregulators of ABCA1.

When SW-13 cells were incubated with 22(R)-OH or 9-CRA, ABCA1 mRNA was increased 8-fold (Figure 1). Simultaneous addition of these ligands had a synergistic effect on ABCA1 levels. In the absence of LXR or RXR ligands, overexpression of wild-type BRG-1, but not the mutant BRG-1 deficient in ATP-hydrolyzing function, upregulated ABCA1 expression levels 50-fold. The synergistic effect of LXR and RXR ligands was retained. The expression levels of the BRG-1 wild-type and mutant proteins were equal on transfection (Figure 1, inset). The basal- and 22(R)-OH–induced ABCA1 levels were increased up to 100-fold, with gradually increasing BRG-1 levels (please see online supplement). These data demonstrate that the BRG-1 subunit of SWI/SNF complex plays a major role in upregulating ABCA1 transcription.

   Figure 1. Upregulation of ABCA1 mRNA levels by BRG-1. SW-13 cells were transfected with either BRG-1 wild-type (wt) or K798R mutant BRG-1 (mut) and incubated after transfection either under noninducing condition (co) or induced with LXR ligand 22(R)-OH (OH; 10 μmol/L), RXR ligand 9-CRA (CRA; 10 μmol/L) either alone or in combination (comb; 10 μmol/L each) for 24 hours. Nontransfected cells (control) were used as a reference. RNA from these cells was isolated, reverse transcribed, and real-time PCR was performed using oligonucleotides specific for ABCA1. mRNA levels (+SD) relative to noninduced control cells is presented from a representative experiment performed in triplicate. Inset shows the expression levels of wild-type and mutant BRG-1 detected by Western blotting from cell lysates.

In the human SWI/SNF chromatin remodeling complex, the ATP-hydrolyzing subunit is either BRG-1 or brm. When the expression plasmid for brm was transfected into SW-13 cells, similar results of ABCA1 mRNA levels were observed compared with BRG-1 overexpression (data not shown). This indicates that either of the SWI/SNF subunits (brm or BRG-1) activates LXR/RXR-mediated transcription of ABCA1.

Next, we tested whether other LXR-regulated genes were also affected by BRG-1 expression. In BRG-1–overexpressing SW-13 cells, phospholipid transfer protein (PLTP) was modestly upregulated (3.4±1.3-fold induction; P<0.01; n=6), whereas sterol regulatory element-binding protein 1c (SREBP1c) was downregulated (mRNA levels 0.4±0.2 compared with control; P<0.001; n=9). In either case, the expression levels of these genes were not affected by LXR ligand 22(R)-OH in BRG-1–overexpressing cells (data not shown). These results indicate that SWI/SNF chromatin remodeling complex is able to influence the expression of several LXR-regulated genes.

ABCA1 Is Regulated by BRG-1 in Several Cell Types

The effect of BRG-1 on ABCA1 expression was demonstrated in 2 other cell lines: 293T and Hep3B. When siRNA directed toward BRG-1 and brm was transfected into 293T cells, mRNA levels of these genes were reduced by 60% to 70% (Figure 2A). There was a comparable reduction of BRG-1 and brm protein levels in these cells (Figure 2A, inset). The reduction of BRG-1/brm affected ABCA1 levels; in noninducing cells, the basal level of ABCA1 was increased 3-fold (Figure 2B, left). Most importantly, the ligand-mediated induction of ABCA1 in 293T cells was attenuated 45% by reducing BRG-1/brm levels (Figure 2B, right).

   Figure 2. Effect of BRG-1/brm siRNA on ABCA1 levels. 293T cells were transfected with siRNA (+siRNA) against BRG-1/brm and incubated after transfection either under noninducing condition (co) or induced with LXR ligand (OH). Mock-transfected cells (–siRNA) were used as a reference. A, Average mRNA levels (+SD) of BRG-1 (black bars) and brm (white bars) from 3 independent experiments is shown relative to nontransfected cells under noninducing conditions. Numbers refer to BRG-1 levels. Inset shows the protein levels of BRG-1 and brm from a representative experiment. **P<0.01 and *** P<0.001 of –siRNA vs +siRNA. B, Average ABCA1 mRNA levels (+SD) in 293T cells from 3 independent experiments. Left, Increase in basal ABCA1 levels with BRG-1/brm siRNA under noninducing conditions (**P<0.01 –siRNA vs +siRNA). Right, Decrease in ABCA1 levels on LXR ligand induction with BRG-1/brm siRNA (***P<0.001 –siRNA vs +siRNA).

Similar effects on the basal ABCA1 levels were observed in Hep3B cells. Increased ABCA1 levels (mRNA with siRNA 1.7±0.2 versus no siRNA; P<0.05; n=3) were observed when BRG-1 and brm mRNA levels were reduced by 80% and 70% (P<0.01 versus no siRNA for BRG-1 and brm; n=3), respectively. Similarly to published data on another hepatocyte cell line (HepG2), ABCA1 levels were not induced by 22(R)-OH,30 and therefore, the effect of siRNA on hydroxycholesterol-mediated induction could not be measured in Hep3B cells. Together, the results from siRNA studies demonstrate that the effect of BRG-1 on ABCA1 mRNA levels is not restricted to SW13 cells but can be observed in other cell types as well.

BRG-1 Effect on ABCA1 Transcription Is Dependent on Promoter DR-4 Element

To localize the promoter element responsible for the BRG-1–mediated upregulation of ABCA1, we used ABCA1 luciferase constructs. In agreement with the mRNA data, ABCA1 promoter activity was increased by LXR and RXR ligands and by overexpression of wild-type BRG-1 (Figure 3). Surprisingly, and in contrast with endogenous mRNA, mutant BRG-1 was also capable of inducing ABCA1 transcription from a plasmid template. The major effect of LXR and RXR ligands in ABCA1 promoter has been attributed to the DR-4 element.16,18,20,25 When this element was mutated from the full-length promoter construct, the ligand- and BRG-1–dependent effects were significantly reduced (Figure 3), demonstrating the importance of this element for ABCA1 transcription.

   Figure 3. ABCA1 promoter activity is increased by wild-type and mutant BRG-1 in DR-4–dependent manner. SW-13 cells were transfected either with 500 ng GFP (control), BRG-1 wild-type, or mutant expression plasmids, together with 500 ng of ABCA1 promoter construct and 100 ng of pRL-TK (renilla luciferase cDNA under thymidine kinase promotor) internal control and incubated as described in Figure 1 legend. Cells were lysed in passive lysis buffer, and luciferase activities were measured using dual-luciferase assay system. The luciferase activities of wild-type (wt) ABCA1 promoter (black bars) and full-length ABCA1 promoter in which the DR-4 element was mutated (ABCA1-DR4; white bars) were calculated by normalizing the values to renilla luciferase values. The results are relative (+SD) to cells transfected with GFP under basal conditions. A representative experiment performed in triplicate is shown. The values refer to wild-type ABCA1 promoter construct. OH indicates 22(R)-OH; CRA, 9-CRA; comb, combination of 22(R)-OH and 9-CRA.

Steroid Receptor Coactivator 1 and BRG-1 Synergistically Activate ABCA1 Transcription

We reported previously that coactivators steroid receptor coactivator 1 (SRC-1) and p300 induced ABCA1 transcription in 293T cells.25 When SW-13 cells were transfected with SRC-1, basal ABCA1 levels were increased 4-fold (4.1±1.8; P<0.05; n=5). Similar activation was obtained with p300 overexpression (3.7±1.4; P<0.05; n=5). Overexpression of these proteins seemed to have a more dramatic effect on 9-CRA–mediated induction than on 22(R)-OH induction because an additional 3- to 5-fold increase of ABCA1 mRNA was observed (P<0.05; n=4 for CRA versus SRC-1+CRA and CRA versus p300+CRA; Figure 4; and data not shown). We also tested whether SRC-1 could further induce BRG-1–mediated activation of ABCA1. SRC-1+BRG-1 coexpression resulted in an additional 2- to 3-fold increase in ABCA1 basal levels compared with BRG-1 transfection alone (Figure 4). This effect was retained in cells induced with LXR or RXR ligands. These data indicate that SRC-1 and BRG-1 synergistically activate ABCA1 transcription.

   Figure 4. SRC-1 and BRG-1 synergistically upregulate ABCA1 expression. SW-13 cells were transfected with expression plasmid encoding SRC-1 (8 μg per transfection) or BRG-1 (4 μg per transfection) and incubated with various agents as explained in Figure 1 legend. mRNA levels of ABCA1 were determined using real-time RT-PCR and are shown relative to the nontransfected (control) cells under basal condition. A representative experiment performed in triplicate is shown.

Interaction of LXR and BRG-1 in Intact Cells

To determine the mechanism by which chromatin remodeling complex affects LXR-mediated regulation of ABCA1, we studied the interaction of LXR and RXR with BRG-1. Immunoprecipitation from cross-linked LXR–overexpressing cells with specific antibodies against FLAG (precipitating epitope-tagged LXR) and RXR coprecipitated BRG-1 protein (Figure 5A). This interaction was present in noninduced cells and in cells incubated with 22(R)-OH but was not observed when the immunoprecipitation was performed using nonspecific rabbit IgG. These results indicate specific interaction between LXR-BRG-1 and RXR-BRG-1. In separate experiments, we were also able to show the interaction between LXR and RXR (data not shown).

   Figure 5. In vivo interaction of LXR/RXR and BRG-1. A, Coimmunoprecipitation of LXR/RXR and BRG-1. 293 cells stably overexpressing LXR under basal (control) or inducing (2-hour incubation with 10 μmol/L 22(R)-OH) were cross-linked with DSP. Coimmunoprecipitation was performed as described in Methods section using specific antibodies against FLAG (precipitates LXR), RXR, BRG-1, or with nonspecific rabbit IgG. Presence of BRG-1 in the coimmunoprecipitations was assayed by Western blotting with anti–BRG-1 antibody. B, Chromatin immunoprecipitation. 293-LXR, 293T, and Hep3B cells were grown under basal conditions or induced with 22(R)-OH for 2 hours, fixed with DSP and formaldehyde, and ChIP assay using anti-FLAG (for tagged LXR in 293–LXR cells), anti-LXR (293T and Hep3B cells), anti-RXR, and anti-BRG-1 antibodies was performed as described in Methods section. The promoter region of ABCA1 surrounding the DR-4 element was amplified by PCR using gene-specific primers. H and G refer to negative (water as template) and positive (100 ng of genomic DNA) PCR controls, respectively. B refers to negative control of the ChIP assay (buffer precipitated with nonspecific rabbit IgG).

We also performed ChIP studies in several cell types. Specific binding of LXR, RXR, and BRG-1 to the DR-4 element of the ABCA1 promoter was demonstrated in 293 cells stably overexpressing LXR, in 293T cells and in Hep3B cells (Figure 5B). In agreement with coimmunoprecipitation data, the binding of BRG-1 to ABCA1 promoter was present in the absence and presence of LXR agonist. Together, these results demonstrate the recruitment of BRG-1 to the DR-4 element of the ABCA1 promoter and physical interaction of LXR/RXR and BRG-1.

    Discussion

Regulation of ABCA1 expression is determined by multiple mechanisms. Protein and mRNA stability play a role together with the use of multiple transcription start sites and competitive binding of different nuclear receptor heterodimers (LXR/RXR, RAR/RXR, TR/RXR) to the same promoter DR-4 element.13–18,31 Certain coregulators, such as SRC-1/p300, NCoR/SMRT, RIP140, MBF-1, ASC-2, SHP, and PGC-1 have been shown to affect LXR and, in some cases, also ABCA1 activity.25,28,29,32–36 However, the role of chromatin remodeling complex on the activation of LXR or ABCA1 has not been determined.

SWI/SNF chromatin remodeling complex affects the transcription of 5% of genes in yeast.3 The catalytic subunits BRG-1 and brm have overlapping but distinct functions because BRG-1 knockout mice are lethal, whereas brm-deficient mice are overweight but otherwise apparently normal.37 BRG-1 and brm activate nuclear hormone receptors and hypoxia-inducible factor 1.1,9,22 On the contrary, BRG-1 preferentially binds and activates zinc finger proteins (including RXR and RAR), whereas brm activates factors with 2 ankyrin repeat proteins.37 In the current study, overexpression of either wild-type BRG-1 or brm activated LXR/RXR-mediated transcription of ABCA1 in SW-13 cells that normally lack these proteins (Figure 1). This indicates that human SWI/SNF subunits can compensate for each other in the activation of LXR/RXR. We also demonstrated that not only ABCA1, but 2 other LXR-regulated genes (SREBP1c and PLTP), were affected by BRG-1. mRNA levels of ABCA1 and PLTP were upregulated in SW-13 cells, but SREBP1c was downregulated by BRG-1 overexpression. More research is needed to determine the mechanism behind the differential effect on these LXR-regulated genes.

The regulation of ABCA1 by BRG-1 was not restricted to SW-13 cells but was also observed in kidney epithelial and hepatocyte cell lines (Figure 2). Most importantly, the upregulation of ABCA1 mRNA levels by LXR ligand was attenuated by 45% when BRG-1 and brm levels were decreased using siRNA (Figure 2B, right). This is in agreement with our findings in which ABCA1 levels were greatly upregulated by LXR and RXR ligands in BRG-1 overexpressing SW-13 cells (Figure 1). In contrast, regulation of basal ABCA1 expression by BRG-1 seems to differ between cell types because overexpressing BRG-1/brm in SW-13 cells leads to increased ABCA1 expression, whereas a similar effect was seen in 293T and Hep3B cells when the level of both proteins was decreased by siRNA (Figures 1 and 2). BRG-1/brm may affect the basal activity of ABCA1 differently in these cells via other transcription factors than LXR/RXR.

Activation of ABCA1 by oxysterols and retinoic acid was preserved in SW13 cells even in the absence of SWI/SNF chromatin remodeling activity (Figures 1, 3, and 4), a result observed previously in the response of the probasin gene to AR receptor ligand DHT, and the response of GR to its ligand DHT.9,27 These data indicate that for some nuclear receptors, ligand-mediated transcriptional activation can occur even in the absence of chromatin remodeling activity. However, the activation is greatly enhanced by the presence of catalytically active subunits of the SWI/SNF complex.

Measurement of endogenous mRNA levels reflect activity on native chromatin contex. This conformational complexity is lacking in plasmid templates, which are, however, widely used and offer useful tools in deciphering the elements responsible for transcriptional effects. Luciferase assays were used to localize the BRG-1–responsive element in the ABCA1 promoter. When the DR-4 element in the promoter was mutated, the BRG-1 effect was abolished, indicating the essential role of this element for activation (Figure 3). An unexpected finding was that mutant BRG-1 induced ABCA1 promoter activity almost to the same extent as the wild-type BRG-1. This had been reported earlier for BRG-1–upregulated GR-responsive mouse mammary tumor virus (MMTV) promoter, as well as for CYP1A1 promoter activated by AHR/ARNT.5,8,27 The explanation probably lies in the differential structure of the "open" template (plasmid) versus "compact" template (native chromatin). In the case of the plasmid template, the ATPase-deficient form of BRG-1 can enhance the transcription by additional mechanisms, such as facilitating interactions between nuclear receptors and other coactivators, or stabilizing interaction with RNA polymerase II.5,27 The difference between mutant BRG-1–mediated activation of ABCA1 on 2 different templates (no activation on "compact" native chromatin template versus activation on "open" plasmid template) also implies that measuring luciferase activity alone may not be sufficient to draw conclusions about transcriptional mechanisms involving chromatin remodeling.

The mechanism by which SWI/SNF complex enhanced the LXR/RXR-mediated transcription of ABCA1 involves the DR-4 element of the promoter, as well as interaction of BRG-1 with LXR/RXR complex. This was demonstrated by deleting the DR-4 element on of the ABCA1 promoter construct (Figure 3), as well as coimmunoprecipitation and ChIP data (Figure 5). The interaction between other nuclear receptors and BRG-1 has been reported previously to be either direct (interaction of BRG-1 with RAR and RXR)37 or indirect, involving coactivators SRC-1/p300 (AR and TR)11 or BAFs (GR and ER).1 Because our coimmunoprecipitations were performed using cross-linked cells, we cannot distinguish between direct interaction of LXR/RXR with BRG-1 versus indirect recruitment of BRG-1 by SRC-1/p300/BAFs. However, we provide further evidence that LXR/RXR, SRC-1, and BRG-1 are all part of the same transcriptional complex for ABCA1. SRC-1 and BRG-1 synergistically activated ABCA1 transcription (Figure 4). This stimulatory effect of SRC-1 was also localized to the ABCA1 DR-4 element (data not shown). The synergy between BRG-1 and SRC-1 or CBP (which has acetyltransferase activity like p300) was reported previously for ER-responsive promoters6 and for CYP1A1 activation by AHR/ARNT heterodimer.8

A unique feature of LXR compared with steroid nuclear receptors (such as GR and ER)6,27 is that the interaction of BRG-1 with LXR complex was ligand independent (Figure 5). Two explanations for this difference are plausible. Unlike steroid receptors, which are transported to nucleus and recruited to promoter elements as homodimers on ligand activation, RXR heterodimers are mainly found in the nucleus and permanently occupy promoters. This indicates a basic difference in the promoter occupancy between steroid receptors and RXR heterodimers. Kadam et al also reported direct, ligand-independent interaction between RXR and BRG-1,37 a result consistent with our findings. Second, whereas steroid receptor ligands (such as ERs and GRs) can easily be depleted from cell cultures (because no endogenous ligands are produced by most cells), LXR ligands are produced endogenously by several cell types. Thus, it is possible that small amounts of oxysterols produced in the cell types used provide endogenous signals for BRG-1 binding to LXR/RXR complex.

In summary, our results show that SWI/SNF chromatin remodeling complex plays a major role in the activation of ABCA1 via LXR/RXR. This activation is mediated by the promoter DR-4 element and involves direct association of LXR/RXR complex and BRG-1. These results are compatible with a model in which the activation of ABCA1 transcription involves LXR/RXR heterodimer binding to DR-4 element and recruitment of coactivators SRC-1/p300 and SWI/SNF chromatin remodeling complex (Figure 6).

   Figure 6. Model of transcriptional activation of ABCA1. In basal SW-13 cells, RXR/LXR heterodimer is bound to the ABCA1 DR-4 element with no coactivators. No transcription/basal activity is observed. On either LXR or RXR ligand activation, coactivators SRC-1 and p300 are able to bind to LXR/RXR, and modest RNA polymerase II (RNA pol II)–mediated activation is observed. When SWI/SNF chromatin complex subunits BRG-1 or brm are introduced into the cells, major rearrangement of the nucleosomal chromatin facilitates recruitment of BAFs. Maximal trascriptional activity is observed. Gray coloring indicates factors that are associating/playing a role in each activation step.

    Acknowledgments

This work was supported by National Institutes of Health Grants HL57976 and HL67294 (P.F., C.F.).

References

Kinyamu HK, Archer TK. Modifying chromatin to permit steroid hormone receptor-dependent transcription. Biochim Biophys Acta. 2004; 1677: 30–45.

Imbalzano AN, Xiao H. Functional properties of ATP-dependent chromatin remodeling enzymes. Adv Protein Chem. 2004; 67: 157–179.

Lusser A, Kadonaga JT. Chromatin remodeling by ATP-dependent molecular machines. BioEssays. 2003; 25: 1192–1200.

Vignali M, Hassan AH, Neely KE, Workman JL. ATP-dependent chromatin-remodeling complexes. Mol Cell Biol. 2000; 20: 1899–1910.

Fryer CJ, Archer TK. Chromatin remodeling by the glucocorticoid receptor requires the BRG1 complex. Nature. 1998; 393: 88–91.

DiRenzo J, Shang Y, Phelan M, Sif S, Myers M, Kingston R, Brown M. BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors involved in histone acetylation. Mol Cell Biol. 2000; 20: 7541–7549.

Chiba H, Muramatsu M, Nomoto A, Kato H. Two human homologues of Saccharomyces cerevisiae SWI2/SNF2 and Drosophila brahma are transcriptional coactivators cooperating with the estrogen receptor and the retinoic acid receptor. Nucleic Acids Res. 1994; 22: 1815–1820.

Wang S, Hankinson O. Functional involvement of the Brahma/SWI2-related gene 1 protein in cytochrome P4501A1 transcription mediated by the aryl hydrocarbon receptor complex. J Biol Chem. 2002; 277: 11821–11827.

Marshall TW, Link KA, Petre-Draviam CE, Knudsen KE. Differential requirement of SWI/SNF for androgen receptor activity. J Biol Chem. 2003; 278: 30605–30613.

Hsiao PW, Fryer CJ, Trotter KW, Wang W, Archer TK. BAF60a mediates critical interactions between nuclear receptors and the BRG1 chromatin-remodeling complex for transactivation. Mol Cell Biol. 2003; 23: 6210–6220.

Huang ZQ, Li J, Sachs LM, Cole PA, Wong J. A role for cofactor-cofactor and cofactor-histone interactions in targeting p300, SWI/SNF and mediator for transcription. EMBO J. 2003; 22: 2146–2155.

Owen JS, Mulcahy JV. ATP-binding cassette A1 protein and HDL homeostasis. Atheroscler Suppl. 2002; 3: 13–22.

Cavelier LB, Qiu Y, Bielicki JK, Afzal V, Cheng JF, Rubin EM. Regulation and activity of the human ABCA1 gene in transgenic mice. J Biol Chem. 2001; 276: 18046–18051.

Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem. 2001; 276: 33969–33979.

Huuskonen J, Abedin M, Vishnu M, Pullinger CR, Baranzini SE, Kane JP, Fielding PE, Fielding CJ. Dynamic regulation of alternative ATP-binding cassette transporter A1 transcripts. Biochem Biophys Res Commun. 2003; 306: 463–468.

Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem. 2000; 275: 28240–28245.

Costet P, Lalanne F, Gerbod-Giannone MC, Molina JR, Fu X, Lund EG, Gudas LJ, Tall AR. Retinoic acid receptor-mediated induction of ABCA1 in macrophages. Mol Cell Biol. 2003; 23: 7756–7766.

Huuskonen J, Vishnu M, Pullinger CR, Fielding PE, Fielding CJ. Regulation of ATP-binding cassette transporter A1 transcription by thyroid hormone receptor. Biochemistry. 2004; 43: 1626–1632.

Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003; 9: 213–219.

Schwartz K, Lawn RM, Wade DP. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun. 2000; 274: 794–802.

Joseph SB, McKilligin E, Pei L, Watson MA, Collins AR, Laffitte BA, Chen M, Noh G, Goodman J, Hagger GN, Tran J, Tippin TK, Wang X, Lusis AJ, Hsueh WA, Law RE, Collins JL, Willson TM, Tontonoz P. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc Natl Acad Sci U S A. 2002; 99: 7604–7609.

Wang F, Zhang R, Beischlag TV, Muchardt C, Yaniv M, Hankinson O. Roles of Brahma and Brahma/SWI2-related gene 1 in hypoxic induction of the erythropoietin gene. J Biol Chem. 2004; 279: 46733–46741.

Liu H, Kang H, Liu R, Chen X, Zhao K. Maximal induction of a subset of interferon target genes requires the chromatin-remodeling activity of the BAF complex. Mol Cell Biol. 2002; 22: 6471–6479.

Ma Z, Chang MJ, Shah R, Adamski J, Zhao X, Benveniste EN. Brg-1 is required for maximal transcription of the human matrix metalloproteinase-2 gene. J Biol Chem. 2004; 279: 46326–46334.

Huuskonen J, Fielding PE, Fielding CJ. Role of p160 coactivator complex in the activation of liver X receptor. Arterioscler Thromb Vasc Biol. 2004; 24: 703–708.

Kurdistani SK, Grunstein M. In vivo protein-protein and protein-DNA cross-linking for genomewide binding microarray. Methods. 2003; 31: 90–95.

Trotter KW, Archer TK. Reconstitution of glucocorticoid receptor-dependent transcription in vivo. Mol Cell Biol. 2004; 24: 3347–3358.

Wagner BL, Valledor AF, Shao G, Daige CL, Bischoff ED, Petrowski M, Jepsen K, Baek SH, Heyman RA, Rosenfeld MG, Schulman IG, Glass CK. Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression. Mol Cell Biol. 2003; 23: 5780–5789.

Hu X, Li S, Wu J, Xia C, Lala DS. Liver x receptors interact with corepressors to regulate gene expression. Mol Endocrinol. 2003; 17: 1019–1026.

Denis M, Bissonnette R, Haidar B, Krimbou L, Bouvier M, Genest J. Expression, regulation, and activity of ABCA1 in human cell lines. Mol Genet Metab. 2003; 78: 265–274.

Wang N, Tall AR. Regulation and mechanisms of ATP-binding cassette transporter A1-mediated cellular cholesterol efflux. Arterioscler Thromb Vasc Biol. 2003; 23: 1178–1184.

Miyata KS, McCaw SE, Meertens LM, Patel HV, Rachubinski RA, Capone JP. Receptor-interacting protein 140 interacts with and inhibits transactivation by, peroxisome proliferator-activated receptor alpha and liver-X-receptor alpha. Mol Cell Endocrinol. 1998; 146: 69–76.

Brendel C, Gelman L, Auwerx J. Multiprotein bridging factor-1 (MBF-1) is a cofactor for nuclear receptors that regulate lipid metabolism. Mol Endocrinol. 2002; 16: 1367–1377.

Kim SW, Park K, Kwak E, Choi E, Lee S, Ham J, Kang H, Kim JM, Hwang SY, Kong YY, Lee K, Lee JW. Activating signal cointegrator 2 required for liver lipid metabolism mediated by liver X receptors in mice. Mol Cell Biol. 2003; 23: 3583–3592.

Brendel C, Schoonjans K, Botrugno OA, Treuter E, Auwerx J. The small heterodimer partner interacts with the liver X receptor alpha and represses its transcriptional activity. Mol Endocrinol. 2002; 16: 2065–2076.

Oberkofler H, Schraml E, Krempler F, Patsch W. Potentiation of liver X receptor transcriptional activity by peroxisome-proliferator-activated receptor gamma coactivator 1 alpha. Biochem J. 2003; 371: 89–96.

Kadam S, Emerson BM. Transcriptional specificity of human SWI/SNF BRG1 and BRM chromatin remodeling complexes. Mol Cell. 2003; 11: 377–389.

 


 

日期:2007年5月18日 - 来自[2005年第25卷第6期]栏目
循环ads

ATP-Binding Cassette Transporter G8 Gene As a Determinant of Apolipoprotein B-100 Kinetics in Overweight Men

From the Lipoprotein Research Unit (D.C.C., G.F.W., P.H.R.B.), School of Medicine and Pharmacology, The Western Australian Institute for Medical Research; and School of Surgery and Pathology (A.J.W., F.M.vB.), University of Western Australia and Department of Biochemistry, Royal Perth Hospital, Perth, Australia.

ABSTRACT

Objective— We examined the influence of genetic variation of the ATP-binding cassette (ABC) transporter G8 on apolipoprotein B (apoB) kinetics in overweight/obese men.

Methods and Results— Very low–density lipoprotein (VLDL) and low-density lipoprotein (LDL) apoB kinetics were determined in 47 men (body mass index 32±3 kg/m2) using stable isotope and multicompartmental modeling to estimate production rate (PR), fractional catabolic rate (FCR), and VLDL to LDL–apoB conversion. Relative to the wild-type (400TT), subjects carrying the ABCG8 400K allele had significantly decreased plasma concentrations of triglycerides, sitosterol, and campesterol, lower PR of VLDL–apoB, and higher VLDL to LDL–apoB conversion (P<0.05). The PR and FCR of LDL–apoB were also significantly higher with 400K allele (P<0.05). No association was found with ABCG8 D19H. Compared with APOE2 or APOE3, APOE4 carriers had significantly higher plasma LDL-cholesterol concentrations and lower LDL–apoB FCR. During multiple regression analysis including age, homeostasis model assessment score, plasma concentrations of sitosterol, and lathosterol, ABCG8 and apoE genotypes were independent determinants of VLDL–apoB PR and LDL–apoB FCR, respectively (P<0.05).

Conclusions— Variation in the ABC transporter G8 appears to independently influence the metabolism of apoB-containing lipoproteins in overweight/obese subjects. This may have therapeutic implications for the management of dyslipidemia in these subjects.

This study demonstrates that subjects carrying the ABCG8 400K allele had lower production rate of VLDL–apoB and higher VLDL to LDL–apoB conversion. The production rate and fractional catabolic rate of LDL–apoB were also higher with 400K allele. During multiple regression analysis, ABCG8 genotype was an independent determinant of VLDL–apoB production rate.

Key Words: ATP binding cassette transporter ? lipoprotein metabolism ? obesity ? cardiovascular disease

Introduction

Obesity induces dyslipidemia, and this may in large measure account for the associated increased risk of cardiovascular disease (CVD).1 Although the precise mechanisms whereby obesity results in dyslipidemia have not been fully established, experimental and human data suggest that the increased availability of cholesterol in the liver may increase the secretion of very low–density lipoprotein (VLDL) apolipoprotein B-100 (apoB-100) and decrease the expression of low-density lipoprotein (LDL) receptors.2 The kinetics of apoB metabolism in vivo, and specifically in obesity, may also depend on allelic variations in genes, such as apoE and apoB signal peptide, that regulate neutral lipid supply to the liver, the intrahepatic processing of apoB, and the clearance of apoB-containing lipoproteins from plasma.3,4

Cholesterol homeostasis is a complex process that involves coordination of intestinal absorption, hepatic synthesis, and biliary excretion of cholesterol. Recent evidence has indicated that cholesterol absorption in humans has a major heritable component.5,6 Moreover, subjects who are high-cholesterol absorbers may be at increased risk of coronary disease.7 The recent identification of the ATP-binding cassette (ABC) G5 and G8 transporters has greatly advanced our understanding of molecular events in sterol absorption and transport.8–10 ABCG5 and G8 are hemitransporters that selectively limit intestinal absorption and promote biliary excretion of neutral sterols.11 Mutations in the genes encoding for ABCG5/G8 have been identified and linked to sitosterolemia.8,10 Allelic variations of the ABC transporter G8 may therefore control the availability of cholesterol in the liver and, by implication, the kinetics of apoB-containing lipoproteins in plasma. In this study, we hypothesized that ABCG8 gene polymorphisms would have independent effects on apoB kinetics in overweight/obese subjects.

Methods

Subjects

We studied 47 nonsmoking overweight/obese men selected from the community with body mass index (BMI) ranging from 25 to 40 kg/m2. None had diabetes mellitus, apoE2/E2 or E4/E4 genotype, macroproteinuria, creatinemia (>120 μmol/L), hypothyroidism, abnormal liver enzymes, or consumed >30 g of alcohol per day. None reported a history of CVD or were taking agents affecting lipid metabolism. The study was approved by the ethics committee of Royal Perth Hospital.

Clinical Protocols

All subjects were admitted to a metabolic ward in the morning after a 14-hour fast. Venous blood was collected for measurements of biochemical analytes. A single bolus of d3-leucine (5 mg/kg body weight) was administered intravenously, and blood samples were taken at baseline and after isotope injection at 5, 10, 20, 30, and 40 minutes, and 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, and 10 hours. Additional fasting blood samples were collected in the morning on the following 4 days of the same week. Diets were assessed for energy and major nutrients using at least 2 24-hour dietary diaries.

ApoB Kinetics Measurement

Laboratory methods for isolation and measurement of isotopic enrichment apoB have been described fully.12 Briefly, apoB in the VLDL and LDL fractions were separated by sequential ultracentrifugation, precipitated by isopropanol, delipidated, hydrolyzed, and derivatized. Isotopic enrichment was determined by ion monitoring of derivatized samples at a mass to charge ratio of 305 and 302. Tracer/tracee ratios were derived for each sample. Production, fractional catabolic rate (FCR), and percentage conversion of apoB were derived using multicompartmental modeling (SAAM-II).

Quantification of ApoB and Other Analytes

ApoB in VLDL and LDL fractions from the pooled plasma samples was isolated and determined by a modified Lowry method.12 Laboratory methods for measurements of lipids, lipoproteins, and other biochemical analytes have been detailed previously.12 Insulin resistance was estimated using the homeostasis model assessment (HOMA) score. Plasma lathosterol, sitosterol, and campesterol concentrations were measured by gas-liquid chromatography and expressed in mmol/Lx102 per mol/L cholesterol.13,14

ABCG8 (T400K, D19H) and ApoE Genotyping

ABCG8 (exon 1 D19H, exon 8 T400K) genotypes were determined by polymerase chain reaction amplification using as forward primer 5' AGG AAA CAG AGT GAA GAC ACT GG 3' and as reverse primer 5' AGA AAG GTT TGA TTT CTC CTA CCC 3' (T400K); and for D19H forward primer 5' ACA CCT GTG TGG AAA GGT AAG GT 3' and reverse primer 5' GCG GGT trichloroacetic acid GTA ATA AAA TGA CAG 3' as described by Hubacek et al.10 ApoE genotype was determined as described by Hixson and Vernier.15

Statistical Analysis

All analyses were performed using SPSS 10.1 (SPSS). Data were expressed as mean±SD or SEM. Group characteristics were compared by t tests, after logarithmic transformation of skewed variables where appropriate. Normalized linkage disequilibrium coefficients (D') were calculated as described previously.16 Associations were examined by multiple regression methods. Binary variables were used to describe ABCG8 genotype (ie, 0 for ABCG8 TT and 1 for ABCG8 TK alleles) and apoE genotype (ie, 0 for apoE2/3 and apoE3/3 and 1 for apoE3/4). Statistical significance was defined at the 5% level using a 2-tailed test.

Results

Table 1 shows the clinical and biochemical characteristics of the 47 men studied. On average, they were middle-aged, centrally obese, normotensive, insulin resistant, and dyslipidemic. With the exception of indices of lipid metabolism, there were no significant group differences in these characteristics according to ABCG8 genotype (Table 1). Average daily energy intake or the proportion of energy intake from carbohydrate, fat, protein, and alcohol did not differ between ABCG8 genotypes (data not shown). Allele frequencies of T400K were 0.86 (wild-type) and 0.14 (variant) and D19H were 0.92 (wild-type) and 0.08 (variant). Significant linkage disequilibrium was not found between T400K and D19H (D'=0.44; P=0.32). These data were comparable and consistent with other reports for white populations.5,17

TABLE 1. Clinical and Biochemical Characteristics of the 47 Subjects

Table 1 also shows the plasma lipids, lipoproteins, apolipoproteins, and noncholesterol sterols in subjects according to ABCG8 genotype. No significant influence of the ABCG8 D19H polymorphism on any lipid or anthropometric parameter was found. Compared with those homozygous for the 400T allele (wild-type), TK individuals had significantly lower plasma triglyceride concentration and VLDL–apoB pool sizes (P<0.01). Intestinal absorption of cholesterol, as reflected by plasma campesterol and sitosterol to cholesterol ratio, was also significantly lower in the TK than TT subjects. These differences remained significant after adjusting for age, BMI, and dietary fat intake (P<0.05). As shown in the Figure, heterozygous ABCG8 TK individuals had significantly lower VLDL–apoB production rate (PR) than TT homozygotes (P=0.005). The PR and FCR of LDL–apoB were significantly higher in the TK than in the TT group (P<0.05). However, the VLDL–apoB FCR did not differ between the groups (P=0.459). Conversion of VLDL–apoB to LDL–apoB was significantly higher in the TK than TT group (58±8 versus 33±3%; P=0.001)

Association of ABCG8 polymorphisms (TT vs TK alleles) with the secretion rates (A) and FCRs (B) of VLDL–apoB and LDL–apoB.

Compared with non-apoE4 carriers, carriers of apoE4 allele had significantly higher plasma LDL cholesterol concentration (P=0.005) and LDL–apoB pool sizes (P=0.004). ApoE4 allele carriers had significantly lower LDL–apoB FCR than the non-apoE4 carriers (0.23±0.12 versus 0.29±0.12 pools per day; P=0.03), with no significant difference in the PRs of both VLDL–apoB and LDL–apoB (14.8±5.8 versus 14.1±7.7 mg/kg per day and 6.0±2.6 versus 5.9±2.7 mg/kg per day, respectively; P>0.05). The FCR of VLDL–apoB was 18% higher in the apoE4 than non-apoE4 carriers, but the difference failed to reach statistical significance (4.5±1.5 versus 3.8±1.1 pools per day; P=0.07).

In multiple regression analysis including age, HOMA score and plasma concentrations of sitosterol and lathosterol, the ABCG8 TK and apoE3/E4 genotypes were independent and significant predictors of a lower hepatic secretion of VLDL–apoB (Table 2 model A; R2=17%; P=0.033) and lower fractional catabolism of LDL–apoB (Table 2 model B; R2=16%; P=0.042), respectively. Including BMI as an independent variable in both these models did not alter these findings (data not shown).

TABLE 2. Association of VLDL–apoB Secretion Rate (A) and LDL Fractional Catabolic Rate (B) With ABCG8 Polymorphsims in Multiple Regression Models Including apoE Phenotype, HOMA Score, Sitosterol, Lathosterol, and Age

Discussion

This is the first study to demonstrate that ABCG8 (T400K) genotype may determine the metabolism of apoB in overweight/obese subjects. Our major finding was that compared with TT, ABCG8 TK individuals had lower VLDL–apoB PR and higher LDL production and FCRs. We also found that the ABCG8 genotype was a significant predictor of the PR of VLDL–apoB independent of age, apoE genotype, HOMA score, and plasma concentrations of sitosterol and lathosterol.

Previous studies of ABCG8 polymorphisms have examined their effect on plasma levels of sterols, insulin sensitivity, and plasma lipid response to statin therapy.5,6,17,18 We extend these reports by examining the influence of ABC transporter G8 polymorphisms on apoB kinetics. The precise molecular mechanisms whereby ABCG8 contributes to apoB metabolism are unclear. Polymorphisms in ABCG8 could contribute to variations in apoB metabolism by controlling liver cholesterol content. Yu et al have shown previously that overexpression of ABC transporter G8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol.19 The ABCG8 K variant may result in structural and physiochemical changes of the transporter that alters its physiological function, such as ATP binding or dimerization. We hypothesize that the ABCG8 K variant lowers intestinal cholesterol absorption and increases biliary cholesterol excretion. This would in turn decrease the cholesterol content in the liver with 2 potential consequences: first, a reduced secretion of VLDL–apoB particles, and second, upregulation of LDL receptor expression. As we have demonstrated here, these effects would accordingly decrease the secretion of VLDL–apoB and increase the removal of LDL–apoB from plasma. Consistent with these kinetic observations, we also found that compared with TT subjects, plasma triglyceride concentration and VLDL–apoB pool size were lower in TK individuals. However, the PR of LDL–apoB was higher in TK individuals, probably because of a preferential conversion of VLDL to LDL. Berge et al reported that there were no significant differences in plasma cholesterol between TT and TK/KK genotypes,5 and our findings (Figure) suggest that this may be attributable to compensatory changes in LDL production and catabolism.

We also confirm previous findings that carriers of apoE4 allele have significantly lower LDL–apoB FCR than non-apoE4 carriers.20–22 In Hep G2 cells, apoE4 is associated with an increased affinity for LDL receptor.23 Hence, it is possible that this mechanism could enhance uptake of VLDL particles in apoE4 subjects, thereby increasing delivery of cholesterol to the liver and consequently downregulating the hepatic LDL receptor. This is consistent with our observation that apoE3/4 subjects tended to have higher VLDL FCR compared with non-apoE4 subjects. Our demonstration that apoE and ABCG8 polymorphisms could independently regulate apoB kinetics by apparently different molecular mechanisms is a new finding that requires further investigation, especially in relation to other genes that regulate lipid substrate supply to the liver and the intrahepatic processing of apoB.3,4

A high rate of cholesterol absorption influences dyslipidemia and risk of CVD.7 Our study provides a kinetic base for the role of ABCG8 genes in regulating lipoprotein metabolism in overweight or obese subject. Whether these genotypic associations determine the response of apoB metabolism to lifestyle changes (eg, weight loss, plant sterol, or fish oil supplementation) or pharmacotherapeutic interventions (eg, Ezetimibe or statins) in overweight/obese or other patient groups also merits examination. Further studies to examine the combined effects of genetic variation in ABC transporters G5 and G8 on intestinal absorption and biliary secretion of sterols and the corresponding relationships with lipoprotein kinetics, in particular HDL metabolism, are warranted.

Acknowledgments

This work was supported by grants from the National Health and Medical Research Council, the National Heart Foundation of Australia, and the National Institutes of Health (NIBIB P41 EB-001975). Support was also provided by the Raine Medical Research Foundation, the Royal Perth Hospital Medical Research Foundation, and Pfizer. P.H.R.B. is a career development fellow of the National Heart Foundation. D.C.C. is a postdoctoral research fellow of the Raine/National Heart Foundation of Australia.

References

Després J-P, Moorjani S, Lupien PJ, Tremblay A, Nadeau A, Bouchard C. Regional distribution of body fat, plasma lipoproteins and cardiovascular disease. Arterioscler Thromb Vasc Biol. 1990; 10: 497–511.

Thompson GR, Naoumova R, Watts GF. Role of cholesterol in regulating apolipoprotien B secretion by the liver. J Lipid Res. 1996; 37: 439–447.

Riches FM, Watts GF, van Bockxmeer FM, Hua J, Song S, Humphries SE, Talmud PJ. Apolipoprotein B signal peptide and apolipoprotein E genotypes as determinants of the hepatic secretion of VLDL apoB in obese men. J Lipid Res. 1998; 39: 1752–1758.

Watts GF, Riches FM, Humphries SE, Talmud PJ, van Bockxmeer FM. Genotypic associations of the hepatic secretion of VLDL apolipoprotein B-100 in obesity. J Lipid Res. 2000; 41: 481–488.

Berge KE, von Bergmann K, Lutjohann D, Guerra R, Grundy SM, Hobbs HH, Cohen JC. Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8. J Lipid Res. 2002; 43: 486–494.

Gylling, H, Miettinen TA. Inheritance of cholesterol metabolism of probands with high or low cholesterol absorption. J Lipid Res. 2002; 43: 1472–1476.

Miettinen TA, Gylling H, Strandberg T, Sarna S; Finnish 4S Investigators. Baseline serum cholestanol as predictor of recurrent coronary events in subgroup of Scandinavian simvastatin survival study. BMJ. 1998; 316: 1127–1130.

Berge KE, Tian H, Graf GA, Yu LQ, Grishin NV, Schultz J, Kwiterovich P, Shan B, Barnes R, Hobbs HH. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science. 2000; 290: 1771–1775.

Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H, Kojima H, Allikmets R, Sakuma N, Pegoraro R, Srivastava AK, Salen G, Dean M, Patel SB. Idenfitication of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat Genet. 2001; 27: 79–83.

Hubacek JA, Berge KE, Cohen JC, Hobbs HH. Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia. Hum Mutat. 2001; 18: 359–360.

Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC, Hobbs HH. Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface. J Clin Invest. 2002; 110: 659–669.

Chan DC, Watts GF, Redgrave TG, Mori TA, Barrett PHR. Apolipoprotein B-100 kinetics in visceral obesity: associations with plasma apolipoprotein C-III concentration. Metabolism. 2002; 29: 1041–1046.

Miettinen TA, Tilvis RS, Kesaniemi YA. Serum plant sterols and cholesterol precursors reflect cholesterol absorption and synthesis in volunteers of a randomly selected male population. Am J Epidemiol. 1990; 131: 20–31.

Mori TA, Croft KD, Puddey IB, Beilin LJ. Analysis of native and oxidized low-density lipoprotein oxysterols using gas chromatography-mass spectrometry with selective ion monitoring. Redox Rep. 1996; 2: 25–34.

Hixson JE, Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res. 1990; 31: 545–548.

Raymond M, Rousset, F. GENEPOP (version 1.2) population genetic software for exact tests and ecumenicism. J Heredity. 1995; 86: 248–249.

Kajinami K, Brousseau ME, Nartsupha C, Ordovas JM, Schaefer EJ. ATP-binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin. J Lipid Res. 2004; 45: 653–656.

Gylling H, Hallikainen M, Pihlajam?ki J, ?gren J, Laakso M, Rajaratnam RA, Rauramaa R, Miettinen TA. Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity. J Lipid Res. 2004; 45: 1660–1665.

Yu L, Hawkins JL, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest. 2002; 110: 671–680.

Demant T, Bedford D, Packard CJ, Shepherd J. Influence of apolipoprotein E polymorphism on apolipoprotein B-100 metabolism in normolipemic subjects. J Clin Invest. 1991; 88: 1490–1501.

Gylling H, Kontula K, Miettinen TA. Cholesterol absorption and metabolism and LDL kinetics in healthy men with different apoprotein E phenotypes and apoprotein B Xba I and LDL receptor Pvu II genotypes. Arterioscler Thromb Vasc Biol. 1995; 15: 208–213.

Welty FK, Lichtenstein AH, Barrett PHR, Jenner JL, Dolnikowski GG, Ernst EJ. Effects of ApoE Genotype on ApoB-48 and ApoB-100 Kinetics With Stable Isotopes in Humans. Arterioscle Throm Vasc Biol. 2000; 20: 1807–1810.

Mamotte CDS, Sturm M, Foo JI, van Bockxmeer FM, Taylor RR. Comparison of the LDL-receptor binding of VLDL and LDL from apoE4 and apoE3 homozygotes. Am J Physiol. 1999; 276: 553–557.

 

日期:2007年5月18日 - 来自[2004年第24卷第11期]栏目
共 1 页,当前第 1 页 9 1 :

ads

关闭

网站地图 | RSS订阅 | 图文 | 版权说明 | 友情链接
Copyright © 2008 39kf.com All rights reserved. 医源世界 版权所有
医源世界所刊载之内容一般仅用于教育目的。您从医源世界获取的信息不得直接用于诊断、治疗疾病或应对您的健康问题。如果您怀疑自己有健康问题,请直接咨询您的保健医生。医源世界、作者、编辑都将不负任何责任和义务。
本站内容来源于网络,转载仅为传播信息促进医药行业发展,如果我们的行为侵犯了您的权益,请及时与我们联系我们将在收到通知后妥善处理该部分内容
联系Email: